| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online December 27, 2007; 10.1104/pp.107.110981 Plant Physiology 146:623-635 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Overexpression of AtMYB44 Enhances Stomatal Closure to Confer Abiotic Stress Tolerance in Transgenic Arabidopsis1,[C],[W],[OA]Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151–921, Korea (C.J., J.S.S., S.W.H., Y.J.K., Y.D.C., J.-J.C.); Department of Food and Nutrition, Seowon University, Chongju 361–742, Korea (C.H.K.); and Division of Bioscience and Bioinformatics, Myongji University, Yongin 449–728, Korea (S.I.S., B.H.N.)
AtMYB44 belongs to the R2R3 MYB subgroup 22 transcription factor family in Arabidopsis (Arabidopsis thaliana). Treatment with abscisic acid (ABA) induced AtMYB44 transcript accumulation within 30 min. The gene was also activated under various abiotic stresses, such as dehydration, low temperature, and salinity. In transgenic Arabidopsis carrying an AtMYB44 promoter-driven β-glucuronidase (GUS) construct, strong GUS activity was observed in the vasculature and leaf epidermal guard cells. Transgenic Arabidopsis overexpressing AtMYB44 is more sensitive to ABA and has a more rapid ABA-induced stomatal closure response than wild-type and atmyb44 knockout plants. Transgenic plants exhibited a reduced rate of water loss, as measured by the fresh-weight loss of detached shoots, and remarkably enhanced tolerance to drought and salt stress compared to wild-type plants. Microarray analysis and northern blots revealed that salt-induced activation of the genes that encode a group of serine/threonine protein phosphatases 2C (PP2Cs), such as ABI1, ABI2, AtPP2CA, HAB1, and HAB2, was diminished in transgenic plants overexpressing AtMYB44. By contrast, the atmyb44 knockout mutant line exhibited enhanced salt-induced expression of PP2C-encoding genes and reduced drought/salt stress tolerance compared to wild-type plants. Therefore, enhanced abiotic stress tolerance of transgenic Arabidopsis overexpressing AtMYB44 was conferred by reduced expression of genes encoding PP2Cs, which have been described as negative regulators of ABA signaling.
Transcription factors are critical regulators of the changes in gene expression that drive developmental processes and environmental stress responses. Over 1,600 transcription factors, representing approximately 6% of the total number of genes, have been identified in the Arabidopsis (Arabidopsis thaliana) genome (Arabidopsis Genome Initiative, 2000  ; Riechmann et al., 2000; Gong et al., 2004). These transcription factors can be classified into several families based on the structure of their DNA-binding domains. Members of the MYB, ERF, bZIP, and WRKY transcription factor families have been implicated in the regulation of stress responses (Schwechheimer et al., 1998; Singh et al., 2002). The MYB family comprises 163 genes, making it one of the largest transcription factor families in Arabidopsis (Yanhui et al., 2006).
The MYB domain consists of two or three 50- to 53-amino acid imperfect repeats that form the helix-turn-helix motifs R1, R2, and R3 (Rosinsky and Atchley, 1998
Extensive functional analyses using large-scale insertional mutagenesis (Meissner et al., 1999
In particular, several R2R3 MYB genes play important roles in the responses to environmental stimuli in Arabidopsis. AtMYB2, in cooperation with AtMYC2, functions as a transcriptional activator in the dehydration- and abscisic acid (ABA)-inducible expression of RD22 (for RESPONSIVE TO DEHYDRATION22; Urao et al., 1993
AtMYB44 (synonym AtMYBR1), together with AtMYB70, AtMYB73, and AtMYB77 (synonym AtMYBR2), belongs to R2R3 MYB subgroup 22. Members of this subgroup share two conserved motifs: TGLYMSPxSP and GxFMxVVQEMIxxEVRSYM (Kranz et al., 1998 The AtMYB44 (At5g67300) gene has an open reading frame of 918 bp encoding a putative 305-amino acid polypeptide with a predicted molecular mass of 33.3 kD. We characterized AtMYB44 in more detail, examining its expression and the phenotype of transgenic plants with altered AtMYB44 expression. Our data indicate that the AtMYB44 transcription factor plays a role in an ABA-mediated signaling pathway that confers abiotic stress tolerance via the enhancement of stomatal closure.
AtMYB44 Expression Northern blots showed that AtMYB44 transcript accumulation was induced within 30 min after the application of 100 µM ABA, 100 µM methyl jasmonate, or 50 µM ethylene to Arabidopsis rosette leaves (Fig. 1A ). AtMYB44 transcript levels also increased when Arabidopsis was exposed to dehydration, high salt levels, or cold (Fig. 1B). The increase in AtMYB44 transcript levels occurred before the increase in RD29A (a marker gene for abiotic stress) transcripts, which was detected at least 1 h after hormone or stress treatment.
In transgenic Arabidopsis expressing the GUS reporter gene driven by the AtMYB44 promoter (approximately 3.0 kb), GUS activity was observed in all tissues examined in transgenic plants, including the filament, stigma, pedicle, sepal, petal, and floral nectary (Fig. 2A ). In most tissues, strong GUS expression was observed in the vasculature. In seedlings grown on Murashige and Skoog medium, the highest levels were observed in the veins and guard cells of the leaf epidermis (Fig. 2B).
For subcellular localization of the protein, AtMYB44 cDNA was fused in frame to the N-terminal side of the GFP marker gene and expressed in transgenic Arabidopsis under the control of the cauliflower mosaic virus (CaMV) 35S promoter. Confocal imaging of GFP revealed that the AtMYB44-GFP fusion protein accumulated in the nuclei (Fig. 2C).
Transgenic Arabidopsis constitutively expressing AtMYB44 cDNA (35S:AtMYB44) were also generated. Five independent T3 or T4 homozygote lines (denoted with numerals 10, 14, 17, 18, and 21) containing one (lines T-10 and T-21) or two (lines T-14, T-17, and T-18) copies of the transgene (Fig. 3A ) and showing the highest levels of expression (Fig. 3B) were selected for further analyses. Western blots confirmed AtMYB44 protein (approximately 33 kD) accumulation in transgenic plants and the absence of protein in the atmyb44 knockout plants (SALK_039074; Fig. 3C).
The 35S:AtMYB44 plants germinated uniformly, as measured 1 week after growing on Murashige and Skoog medium (Fig. 4A ). In early stages of vegetative growth, however, rosette leaves of 35S:AtMYB44 plants were smaller, but became longer and wider than those of wild-type plants after flowering (Fig. 4B). Transgenic plants were dwarfed during the first 5 weeks of growth and were prostrate compared to wild-type plants (Fig. 4C). Extent of growth retardation was correlated with the expression level of the transgene in the transgenic plants.
Flowering time also differed between wild-type and 35S:AtMYB44 plants, as determined when the main florescence shoot elongated to 1 cm. Wild-type plants began to flower at 30 d after sowing (DAS), whereas AtMYB44 transgenic plants took 36 to 37 DAS to reach the same stage (Fig. 4D). At this time point, all 35S:AtMYB44 plants had 16 to 18 leaves, whereas wild-type and atmyb44 knockout plants had 13 leaves on average per rosette. Thus, the delay of flowering was not merely caused by a slower overall growth rate, but reflected developmental retardation in the flowering process. When flowering (i.e. 6 weeks after sowing), heights of transgenic plants were comparable to that of wild-type plants. Adult 35:AtMYB44 plants had much shorter petioles and smaller seeds than wild-type plants; atmyb44 knockout plants exhibited no distinguishable phenotypes in terms of germination, growth, and flowering when compared to wild-type plants.
Without treatment with ABA, the seed germination rate of 35S:AtMYB44 plants was comparable to that of wild-type plants (Fig. 5A ). However, ABA inhibited germination of 35S:AtMYB44 plants more severely than that of wild-type plants, indicating ABA hypersensitivity of transgenic plants. Treatment with 3 µM ABA decreased the seed germination rate of 35S:AtMYB44 plants to approximately 20%, whereas wild-type seeds retained 70% germination under the same conditions. The atmyb44 T-DNA insertion knockout line showed no difference from wild-type plants in the ABA germination experiment.
Stomata of 35S:AtMYB44 plants had smaller guard cells and apertures than did wild-type plants by approximately 80% (Fig. 5B). Density of guard cells (numbers on unit area) was not differentiated in 35S:AtMYB44 when compared to wild-type plants (data not shown). ABA treatment resulted in a higher rate of stomatal closure in 35S:AtMYB44 plants than in wild-type plants. Treatment with 1 µM ABA reduced the stomatal apertures of wild-type plants to approximately 85% of those of nontreated plants. In 35S:AtMYB44 plants, the same treatment reduced stomatal apertures to 60% to 70% of those of nontreated plants. Therefore, transgenic plants overexpressing AtMYB44 exhibited more rapid ABA-induced stomatal closure than did wild-type plants. Stomatal apertures of atmyb44 knockout plants were slightly larger (approximately 105%) than those of wild-type plants and were reduced to 80% level in this experiment.
The rate of water loss from 35S:AtMYB44 plants was lower than that from wild-type plants, as measured by the fresh-weight loss of detached shoots (Fig. 6A ). After dehydration for 3 h, the fresh weight of 35S:AtMYB44 plants was reduced to approximately 60%, whereas wild-type and atmyb44 knockout plants retained 70% of their initial weight.
In addition, three 35S:AtMYB44 lines had higher survival rates than did wild-type plants on rewatering after 12 d of water deprivation (Fig. 6B). In 10 independent experiments, 231 of 282 35S:AtMYB44 (T-21 line) plants survived this test, for a survival rate of 82%, whereas 70 of 411 (17%) wild-type plants and 11 of 134 (8%) atmyb44 knockout plants survived. Two other 35S:AtMYB44 lines, T-17 (252 of 283) and T-18 (176 of 198), both had 89% survival rates. The 35S:AtMYB44 plants also showed significantly enhanced salt stress tolerance. On watering with increasing concentrations of NaCl up to 300 mM, transgenic plants grew relatively well, whereas wild-type plants became wilted and chlorotic (Fig. 6C). In 10 independent experiments, 292 of 353 T-21 line plants survived the salt tolerance test, for a survival rate of 83%, whereas 40 of 229 (17%) wild-type plants and nine of 131 (7%) atmyb44 knockout plants survived. Lines T-17 (243 of 278) and T-18 (209 of 235) had 87% and 89% survival rates, respectively.
Microarray experiments were performed twice using 10 µg of total RNA extracted from wild-type or transgenic Arabidopsis plants (line T-21) treated with or without 250 mM NaCl for 24 h. Hybridization was conducted using Affymetrix ATH1 genome arrays. Microarray experiments using the synthetic oligonucleotide chip demonstrated a high degree of reproducibility between the two sets of independent experiments. Transcript-level data were deposited in ArrayExpress (http://www.ebi.ac.uk/arrayexpress) under accession number E-ATMX-30. Only probe sets that showed significant differences in the two experiments were selected for further analysis. Without salt treatment, 35S:AtMYB44 and atmyb44 knockout Arabidopsis did not show significant alteration in overall expression patterns (Supplemental Tables S1 and S2). Based on the 2-fold criterion, 112 (0.5% of the total 22,500 probe sets) and 26 (0.1% of the total) genes, respectively, had altered transcription levels. By contrast, on treatment with 250 mM NaCl for 24 h, 35S:AtMYB44 plants exhibited significantly altered gene expression patterns. Compared to wild-type plants, 816 genes (3.6% of the total) had transcription levels enhanced by more than 2-fold in 35S:AtMYB44 transgenic plants, whereas 496 genes (2.2% of the total) had transcription levels reduced by more than 2-fold (Supplemental Table S3). In atmyb44 knockout plants, with the salt treatment, 102 genes (0.5% of the total) had transcription levels enhanced by more than 2-fold, whereas 38 genes (0.2% of the total) had 2-fold lower levels compared to wild-type plants (Supplemental Table S4). Genes showing enhanced salt-induced expression in 35S:AtMYB44 plants included those encoding aquaporins, arabinogalactan proteins (AGPs), auxin-induced proteins, cell wall biosynthetic or modifying enzymes, chlorophyll biosynthetic enzymes, and RNA-binding proteins (Supplemental Table S3). In addition, enhanced transcript levels of several types of protein kinase, xyloglucan endotransglucosylase/hydrolase, and calcium-binding proteins were observed in salt-treated 35S:AtMYB44 plants. Microarray analysis revealed that transcript accumulation of well-studied ABA-dependent abiotic stress-inducible marker genes was not significantly enhanced in 35S:AtMYB44 transgenic plants on treatment with 250 mM NaCl, but was comparable to that in wild-type plants (Table I ). In particular, the numbers of gene transcripts encoding DREB/CBF and AREB, which bind to the dehydration-responsive element (DRE/CRT) and the ABA-responsive element (ABRE), respectively, were not enriched or rather reduced in some cases.
Instead, salt-induced activation of the genes encoding Ser/Thr protein phosphatases 2C (PP2Cs) was suppressed in 35S:AtMYB44 transgenic plants (Table I). Salt induction of AtHB-7 and AtHB-12, which are regulated by ABI1 in ABA signaling (Hoth et al., 2002 ), was also decreased (Supplemental Table S3). In addition, salt-induced expression of the genes encoding proteins involved in flavonoid biosynthesis, such as CHS, DFR, and F3H, was lower in 35S:AtMYB44 plants than in wild-type plants. Notably, the expression level of various cytochrome P450 genes was also lower in 35S:AtMYB44 plants than in wild-type plants, supporting a previous observation that expression of these genes is related to abiotic stresses (Narusaka et al., 2004). The result from microarray experiments on abiotic stress marker genes was confirmed by northern blots (Fig. 7 ). No increase in the well-known drought/salt stress marker genes RD29A, RD22, and RAB18 was observed in transgenic plants, whereas the increase in the PP2C-encoding genes, such as ABI1, ABI2, AtPP2CA, HAB1, and HAB2, was diminished in 35S:AtMYB44 plants. The atmyb44 knockout mutant line exhibited somewhat enhanced salt-induced expression of the PP2C-encoding genes.
AtMYB44 transcript accumulation was induced within 30 min after ABA, methyl jasmonate, or ethylene was applied to Arabidopsis rosette leaves (Fig. 1A). Expression of AtMYB44 was also induced by dehydration, salt treatment, and low temperatures (Fig. 1). The increase in transcript accumulation occurred rapidly (i.e. within 30 min) and preceded the increase in transcripts of the ABA-inducible abiotic stress response marker gene RD29A (Fig. 1B). This is consistent with previous reports that AtMYB44 transcripts are induced in most tissues and by a variety of hormone treatments, environmental conditions, and microbial infections (Kranz et al., 1998 ; Yanhui et al., 2006). In our previous microarray experiment, AtMYB44 was identified as a jasmonate-inducible gene (Jung et al., 2007). The signaling mechanism leading to the multihormonal activation of AtMYB44 has not been investigated.
We found that six copies of the highly conserved RY motif CATGCA(TG), an essential target of FUS3 and ABI3 transcription factors (Mönke et al., 2004
Transgenic Arabidopsis overexpressing AtMYB44 (35S:AtMYB44) was hypersensitive to ABA during seed germination, dwarfed in the early stages of growth, and delayed in flowering (Fig. 4). Similar phenotypes have been observed in Arabidopsis lines that overexpress well-known ABA-dependent, drought-response genes such as DREB1A/CBF3 (Kasuga et al., 1999
In AtMYB44 promoter-GUS expression assays, particularly high levels of GUS activity were observed in leaf epidermal guard cells (Fig. 2B). This concurs with the results of microarray analyses, which showed that AtMYB44 was induced by ABA preferentially in guard cells compared to mesophyll cells (Leonhardt et al., 2004
The stomata of 35S:AtMYB44 plants had smaller guard cells and apertures that were approximately 80% of the size of those in wild-type plants (Fig. 5B). By contrast, overexpression of genes that encode vacuolar Ca2+-activated channel TPC1, which is involved in stomatal movement (Peiter et al., 2005
Reduced stomatal size has been observed in many transgenic or mutant Arabidopsis plants in which the genes that modulate the stomatal aperture have been manipulated. For instance, overexpression of AtMYB61 (Liang et al., 2005 Similar to transgenic Arabidopsis overexpressing the genes that modulate the stomatal aperture, stomatal closure was increased in 35S:AtMYB44 plants in response to ABA compared to wild-type plants (Fig. 5B). Furthermore, transgenic plants showed enhanced dehydration and salinity resistance compared to wild-type plants (Fig. 6). Therefore, AtMYB44 functions as a positive regulator of ABA-mediated stomatal closure.
Huang et al. (2007) On salt treatment, compared to wild-type plants, 35S:AtMYB44 plants exhibited significantly altered gene expression patterns (Supplemental Table S3). This could be primary or secondary effects of AtMYB44 overproduction and could explain the cause and consequence of the enhanced salt stress tolerance of 35S:AtMYB44 plants. Genes showing much higher increased expression levels in the 35S:AtMYB44 plants on salt treatment included those involved in water transport, auxin response, cell wall biosynthesis or modification, chlorophyll biosynthesis, transcriptional regulation, and protein phosphorylation.
Aquaporins are water-channel proteins of intracellular (tonoplast) and plasma membranes and play a crucial role in plant-water relationships triggered by various abiotic stresses, such as drought, high salinity, and cold (Daniels et al., 1996
Microarray analysis (Table I) and northern blots (Fig. 7) revealed that expression of major abiotic stress-responsive genes, including RD29A, RD22, and RAB18, was not reinforced in 35S:AtMYB44 plants under salt stress. This suggests that drought/salt stress tolerance exhibited by AtMYB44 transgenic plants was not conferred by the proteins that are encoded by these genes. Instead, expression of genes that encode a group of Ser/Thr PP2Cs, such as ABI1, ABI2, AtPP2CA, HAB1, and HAB2, was suppressed in 35S:AtMYB44 plants and enhanced in atmyb44 knockout plants. These proteins belong to group A PP2Cs (Schweighofer et al., 2004
Enhanced salt stress tolerance of 35S:AtMYB44 plants appears, at least in part, to be conferred by reduced ABI2 activity triggering a negative feedback loop of the SOS2-mediated stress tolerance response. ABI2 interacts with SOS2 (Ohta et al., 2003
As described, expression of AtMYB44 was suppressed in the abi3 mutant (Kirik et al., 1998
The atmyb44 knockout line showed somewhat reduced drought/salt stress tolerance (Fig. 6) and enhanced salt-induced expression of PP2C-encoding genes compared to wild-type plants (Fig. 7). However, the overall phenotype of the mutant was not obviously different from that of wild-type plants. This is presumably because of the functional redundancy of transcription factors. In particular, other R2R3 MYB subgroup 22 genes respond to environmental stresses very similarly, as indicated by significant up-regulation in the sos2 mutant (Kamei et al., 2005
Plant Materials and Treatments Arabidopsis (Arabidopsis thaliana) ecotype Columbia (Col-0) was used throughout this study. Seeds of the atmyb44 T-DNA insertion line (SALK_039074) were obtained from The Arabidopsis Information Resource (TAIR). A homozygous atmyb44 knockout line was isolated from TAIR seeds. Plants were grown on soil or one-half-strength Murashige and Skoog agar medium (Duchefa) in a growth chamber maintained at 22°C to 24°C and 60% relative humidity under long-day conditions (16-h-light/8-h-dark cycle). For chemical treatment, a solution of 100 µM (±)-ABA (Sigma product no. A-1049) was applied to the surface of solid Murashige and Skoog agar medium in which 2-week-old seedlings were growing. Petri dishes were then sealed with parafilm. Abiotic stresses were applied to 2-week-old seedlings either by drying on Whatman 3MM paper (dehydration treatment), treating with 250 mM NaCl (salt treatment), or incubating at 4°C under continuous light (cold treatment). After each treatment, sample seedlings or leaves were harvested and frozen immediately in liquid nitrogen until use in northern blotting.
For the germination assays, approximately 50 seeds were placed on one-half-strength Murashige and Skoog agar medium containing 1% Suc and different concentrations of ABA. To break dormancy, seeds were incubated at 4°C for 4 d in the dark before germination and were subsequently grown in a growth chamber as described above. Seed germination was followed for 7 d. Seeds were counted as germinated when the radicles had emerged by 1 mm. The germination rate was calculated as a percentage of the total number of seeds plated.
A full-length AtMYB44 cDNA (EST 119B8) was obtained from TAIR. For the transformation, a DNA fragment containing the entire coding region plus the 3'-untranslated region was amplified from the EST clone by PCR. The cDNA fragment was inserted into the pBI121 vector (CLONTECH) from which the GUS gene had been removed at the XbaI and BamHI sites, fusing the fragment downstream from the CaMV 35S promoter.
For gene transformation, a DNA construct was transformed into 5-week-old Arabidopsis using Agrobacterium tumefaciens strain C58C1 and the floral-dip method (Clough and Bent, 1998
The atmyb44 T-DNA insertion line (SALK_039074) was obtained from the SALK collection. Plant lines homozygous for the T-DNA insertion were selected by PCR following a standard procedure (Alonso et al., 2003
To investigate AtMYB44 gene expression, approximately 3.0 kb of the promoter (–2,976 to –1 from the translation initiation codon) was amplified by PCR from genomic DNA. The PCR product was inserted into the pCAMBIA 1391Z vector at the PstI and BamHI sites upstream from the GUS gene. Twenty-five hygromycin-resistant transgenic (T1) plants were obtained. Four single-copy insertion lines were identified by Southern blotting (data not shown). Histochemical assays for GUS activity in transgenic plants were performed as described by Jefferson et al. (1987)
For subcellular localization, the cDNA fragment containing the AtMYB44 coding region without stop codon was amplified from the TAIR EST 119B8 clone by PCR. The PCR product was then inserted downstream from the CaMV 35S promoter and in frame with the 5' terminus of the GFP gene in the pGWB5 vector (obtained from Dr. Tsuyoshi Nakagawa) using the Gateway (Invitrogen) system, according to the manufacturer's instructions. Thirty-two and 12 kanamycin- and hygromycin-resistant transgenic (T1) plants integrating 35S:AtMYB44-GFP and 35S:GFP, respectively, were obtained. At least five individual T3 transgenic lines were used for the subcellular localization experiment. Young roots of 2-week-old transgenic plants were examined for GFP fluorescence under a confocal laser-scanning microscope LSM510 (Carl Zeiss).
For the drought tolerance test, plants were initially grown on soil under a normal watering regime for 4 weeks. Watering was then halted and observations were taken after a further 12 d without water. When wild-type plants exhibited lethal effects of dehydration, watering was resumed and the plants were allowed to grow for a subsequent 3 d. For the salt tolerance test, 4-week-old plants were watered for 12 d at 4-d intervals with increasing concentrations of NaCl: 100, 200, and 300 mM. To measure stomatal closure, stomata were fully opened prior to ABA treatment. Rosette leaves of 5-week-old plants were detached and floated (abaxial side down) on opening solution containing 10 mM MES-KOH (pH 6.15), 30 mM KCl, and 1 mM CaCl2, and incubated under lights for 2 h. Leaves were then treated with ABA for 2 h by adding it to the solution to the required concentration. Stomatal apertures in epidermal peels were observed under an Axiophot (Carl Zeiss) microscope coupled to a CCD camera. The size of the stomatal apertures was measured using a digital ruler. The sizes of at least 50 stomatal apertures were measured for each treatment. For transpiration (water loss) measurements, aerial parts of the plants were separated from the roots, placed on weighing dishes, and allowed to dry slowly on the laboratory bench (25°C, 60% relative humidity). Weights of the samples were recorded at regular intervals.
For genomic Southern blots, 5 µg of genomic DNA were digested with restriction enzymes, separated on 0.8% agarose gels, and transferred to nylon membranes. Northern-blot analysis was performed with total RNA extracted from frozen, ground samples using the phenol-SDS-LiCl method (Carpenter and Simon, 1998
For antibody production, an AtMYB44 cDNA fragment encoding a carboxy-terminal region of the protein (AtMYB44
Two independent biological replicates of microarray experiments were performed using 5-week-old wild-type, 35S:AtMYB44, and atmyb44 knockout plants treated with or without 250 mM NaCl. Twenty-four hours after treatment, total RNA was isolated from the rosette leaves using Concert plant RNA purification reagent (Invitrogen) and purified using the RNeasy mini kit (Qiagen). Using 10 µg of total RNA, double-stranded cDNA was synthesized with a T7 promoter-containing oligo(dT) primer using a GeneChip one-cycle cDNA synthesis kit (Affymetrix), followed by in vitro transcription using a GeneChip IVT labeling kit (Affymetrix). Resulting cRNA was fragmented for hybridization to Affymetrix ATH1 genome arrays using an Affymetrix Fluidics Station 450 according to the manufacturer's instructions (GeneChip Expression Analysis Technical Manual). The microarray was scanned using an Agilent GeneArray Scanner (Affymetrix). Scanned images were processed and analyzed using Microarray Suite 5.0 software (Affymetrix), as described previously (Leonhardt et al., 2004
The following materials are available in the online version of this article.
We thank Prof. Youngsook Lee of Pohang University for technical advice on the guard cell experiments. The pGWB5 vector was used with the kind permission of Dr. Tsuyoshi Nakagawa of the Research Institute of Molecular Genetics, Shimane University, Japan. Received October 15, 2007; accepted December 16, 2007; published December 27, 2007.
1 This work was supported by the Crop Functional Genomics Center (grant no. CG2142), which is funded by the Korea Ministry of Science and Technology; the BioGreen 21 program of the Rural Development Administration (grant no. 2005–0301034354); the Korea Research Foundation (grant no. KRF–2006–005–J04701); and the Ministry of Education and Human Resources Development Basic Research Promotion Fund (Brain Korea 21 project).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jong-Joo Cheong (cheongjj{at}snu.ac.kr).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.110981 * Corresponding author; e-mail cheongjj{at}snu.ac.kr.
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63–78 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815[CrossRef][Medline] Carpenter CD, Simon AE (1998) Preparation of RNA. Methods Mol Biol 82: 85–89[Medline] Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol 129: 661–677 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][ISI][Medline] Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M, Leonhardt N, Dellaporta SL, Tonelli C (2005) A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr Biol 15: 1196–1200[CrossRef][ISI][Medline] Daniels MJ, Chaumont F, Mirkov TE, Chrispeels MJ (1996) Characterization of a new vacuolar membrane aquaporin sensitive to mercury at a unique site. Plant Cell 8: 589–599 Denekamp M, Smeekens SC (2003) Integration of wounding and osmotic stress signals determines the expression of the AtMYB102 transcription factor gene. Plant Physiol 132: 1415–1423 Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675–1690 Gazzarrini S, Tsuchiya Y, Lumba S, Okamoto M, McCourt P (2004) The transcription factor FUSCA3 controls developmental timing in Arabidopsis through the hormones gibberellin and abscisic acid. Dev Cell 7: 373–385[CrossRef][ISI][Medline] Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854–1865 Gong W, Shen YP, Ma LG, Pan Y, Du YL, Wang DH, Yang JY, Hu LD, Liu XF, Dong CX, et al (2004) Genome-wide ORFeome cloning and analysis of Arabidopsis transcription factor genes. Plant Physiol 135: 773–782 Gosti F, Beaudoin N, Serizet C, Webb AA, Vartanian N, Giraudat J (1999) ABI1 protein phosphatase 2C is a negative regulator of abscisic acid. Plant Cell 11: 1897–1910 Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler VL (2000) Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R. Proc Natl Acad Sci USA 97: 13579–13584 Halfter U, Ishitani M, Zhu JK (2000) The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proc Natl Acad Sci USA 97: 3735–3740 Hashimoto M, Negi J, Young J, Israelsson M, Schroeder JI, Iba K (2006) Arabidopsis HT1 kinase controls stomatal movements in response to CO2. Nat Cell Biol 8: 391–397[CrossRef][ISI][Medline] Hernandez JA, Campillo A, Jimenez A, Alacon JJ, Sevilla F (1999) Response of antioxidant systems and leaf water relations to NaCl stress in pea plants. New Phytol 141: 241–251[CrossRef][ISI] Hoth S, Morgante M, Sanchez JP, Hanafey MK, Tingey SV, Chua NH (2002) Genome-wide gene expression profiling in Arabidopsis thaliana reveals new targets of abscisic acid and largely impaired gene regulation in the abi1-1 mutant. J Cell Sci 115: 4891–4900[CrossRef][ISI][Medline] Huang D, Jaradat MR, Wu W, Ambrose SJ, Ross AR, Abrams SR, Cutler AJ (2007) Structural analogs of ABA reveal novel features of ABA perception and signaling in Arabidopsis. Plant J 50: 414–428[CrossRef][ISI][Medline] Huang MD, Wu WL (2007) Overexpression of TMAC2, a novel negative regulator of abscisic acid and salinity responses, has pleiotropic effects in Arabidopsis thaliana. Plant Mol Biol 63: 557–569[CrossRef][ISI][Medline] Jang JY, Kim DG, Kim YO, Kim JS, Kang H (2004) An expression analysis of a gene family encoding plasma membrane aquaporins in response to abiotic responses in Arabidopsis thaliana. Plant Mol Biol 54: 713–725[CrossRef][ISI][Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901–3907[ISI][Medline] Jin H, Martin C (1999) Multifunctionality and diversity within the plant MYB-gene family. Plant Mol Biol 41: 577–585[CrossRef][ISI][Medline] Jung C, Lyou SH, Yeu SY, Kim MA, Rhee S, Kim M, Lee JS, Choi YD, Cheong JJ (2007) Microarray-based screening of jasmonate-responsive genes in Arabidopsis thaliana. Plant Cell Rep 26: 1053–1063[CrossRef][ISI][Medline] Kamei A, Seki M, Umezawa T, Ishida J, Satou M, Akiyama K, Zhu JK, Shinozaki K (2005) Analysis of gene expression profiles in Arabidopsis salt overly sensitive mutants sos2-1 and sos3-1. Plant Cell Environ 28: 1267–1275[CrossRef] Kang JY, Choi HI, Im MY, Kim SY (2002) Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 14: 343–357 Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287–291[CrossRef][ISI][Medline] Kirik V, Kölle K, Miséra S, Bäumlein H (1998) Two novel MYB homologues with changed expression in late embryogenesis-defective Arabidopsis mutants. Plant Mol Biol 37: 819–827[CrossRef][ISI][Medline] Kirik V, Lee MM, Wester K, Herrmann U, Zheng Z, Oppenheimer D, Schiefelbein J, Hulskamp M (2005) Functional diversification of MYB23 and GL1 genes in trichome morphogenesis and initiation. Development 132: 1477–1485 Kranz HD, Denekamp M, Greco R, Jin H, Leyva A, Meissner RC, Petroni K, Urzainqui A, Bevan M, Martin C, et al (1998) Towards functional characterization of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J 16: 263–276[CrossRef][ISI][Medline] Kuhn JM, Boisson-Dernier A, Dizon MB, Maktabi MH, Schroeder JI (2006) The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effects of abh1 on AtPP2CA mRNA. Plant Physiol 140: 127–139 Lai LB, Nadeau JA, Lucas J, Lee EK, Nakagawa T, Zhao L, Geisler M, Sack FD (2005) The Arabidopsis R2R3 MYB proteins FOUR LIPS and MYB88 restrict divisions late in the stomatal cell lineage. Plant Cell 17: 2754–2767 Lamport DTA, Kieliszewski MJ, Showalter AM (2006) Salt stress upregulates periplasmic arabinogalactan proteins: using salt stress to analyse AGP function. New Phytol 169: 479–492[CrossRef][ISI][Medline] Lee MM, Schiefelbein J (2001) Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. Development 128: 1539–1546[Abstract] Leonhardt N, Kwak JM, Robert N, Waner D, Leonhardt G, Schroeder JI (2004) Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. Plant Cell 16: 596–615 Leung J, Merlot S, Giraudat J (1997) The Arabidopsis ABSCISIC ACID-INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatase 2C involved in abscisic acid signal transduction. Plant Cell 9: 759–771[Abstract] Liang YK, Dubos C, Dodd IC, Holroyd GH, Hetherington AM, Campbell MM (2005) AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana. Curr Biol 15: 1201–1206[CrossRef][ISI][Medline] Lin BL, Wang HJ, Wang JS, Zaharia I, Abrams SR (2005) Abscisic acid regulation of heterophylly in Marsilea quadrifolia L.: effects of R-(–) and S-(+) isomers. J Exp Bot 56: 2935–2948 Lipsick JS (1996) One billion years of Myb. Oncogene 13: 223–235[ISI][Medline] Liu J, Ishitani M, Halfter U, Kim CS, Zhu JK (2000) The Arabidopsis thaliana SO2 gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci USA 97: 3730–3734 Ma L, Sun N, Liu X, Jiao Y, Zhao H, Deng XW (2005) Organ-specific expression of Arabidopsis genome during development. Plant Physiol 138: 80–91 Mandaokar A, Thines B, Shin B, Markus Lange B, Choi G, Koo YJ, Yoo YJ, Choi YD, Choi G, Browse J (2006) Transcriptional regulators of stamen development in Arabidopsis identified by transcriptional profiling. Plant J 46: 984–1008[CrossRef][ISI][Medline] Martin C, Paz-Ares J (1997) MYB transcription factors in plants. Trends Genet 13: 67–73[CrossRef][ISI][Medline] Meissner RC, Jin H, Cominelli E, Denekamp M, Fuertes A, Greco R, Kranz HD, Penfield S, Petroni K, Urzainqui A, et al (1999) Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes. Plant Cell 11: 1827–1840 Merlot S, Gosti F, Guerrier D, Vavasseur A, Giraudat J (2001) The ABI1 and ABI2 protein phosphatases 2C act in a negative feedback regulatory loop of the abscisic acid pathway. Plant J 25: 295–303[CrossRef][ISI][Medline] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
N) was amplified by PCR using the primers CGGATCCTACGACCATCGGGGTTAC (for the N-terminal side of the protein) and GGAATTCCTACTCGATTCTCCCAAC (for the C-terminal side). The PCR product was inserted into the pRSET A expression vector (Invitrogen) at the BamHI and EcoRI sites (restriction sites are underlined in the primer sequences) and transformed into Escherichia coli strain BL21 (DE3) pLysS. Protein expression was induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside at 37°C for 3 h. His-tagged AtMYB44