| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online May 25, 2007; 10.1104/pp.107.100321 Plant Physiology 145:29-40 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
A Chlorophyll-Deficient Rice Mutant with Impaired Chlorophyllide Esterification in Chlorophyll Biosynthesis1,[W],[OA]National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing 210095, China (Z.W., B.H., L.J., C.W., J.W.); National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China (X.Z., J.W., X.G., L.W., N.S., H.Z., J.W.); and Zhenjiang Agriculture Science Institute, Zhenjiang 212400, China (L.D., S.S.)
Chlorophyll (Chl) synthase catalyzes esterification of chlorophyllide to complete the last step of Chl biosynthesis. Although the Chl synthases and the corresponding genes from various organisms have been well characterized, Chl synthase mutants have not yet been reported in higher plants. In this study, a rice (Oryza Sativa) Chl-deficient mutant, yellow-green leaf1 (ygl1), was isolated, which showed yellow-green leaves in young plants with decreased Chl synthesis, increased level of tetrapyrrole intermediates, and delayed chloroplast development. Genetic analysis demonstrated that the phenotype of ygl1 was caused by a recessive mutation in a nuclear gene. The ygl1 locus was mapped to chromosome 5 and isolated by map-based cloning. Sequence analysis revealed that it encodes the Chl synthase and its identity was verified by transgenic complementation. A missense mutation was found in a highly conserved residue of YGL1 in the ygl1 mutant, resulting in reduction of the enzymatic activity. YGL1 is constitutively expressed in all tissues, and its expression is not significantly affected in the ygl1 mutant. Interestingly, the mRNA expression of the cab1R gene encoding the Chl a/b-binding protein was severely suppressed in the ygl1 mutant. Moreover, the expression of some nuclear genes associated with Chl biosynthesis or chloroplast development was also affected in ygl1 seedlings. These results indicate that the expression of nuclear genes encoding various chloroplast proteins might be feedback regulated by the level of Chl or Chl precursors.
Chlorophyll (Chl) molecules universally exist in photosynthetic organisms. They perform essential processes of harvesting light energy in the antenna systems and driving electron transfer in the reaction centers (Fromme et al., 2003  ). Their metabolism has been extensively studied in various organisms by both biochemical (Pontoppidan and Kannangara, 1994) and genetic approaches (Bollivar et al., 1994a; Nakayashiki et al., 1995; Tanaka et al., 1998). Early enzymatic steps of Chl biosynthesis in converting 5-aminolevulinate acid (ALA) to protoporphyrin IX (Proto IX) are shared with the heme biosynthesis pathway. Many essential data regarding the identity of the associated enzymes were obtained from studies on nonphotosynthetic organisms such as Escherichia coli (Narita et al., 1996). The later steps of Chl biosynthesis are common with bacteriochlorophyll a biosynthesis (Porra, 1997; Suzuki et al., 1997). Directed mutational analysis with a photosynthetic bacterium, Rhodobacter capsulatus, provided abundant information on the genes involved in bacteriochlorophyll biosynthesis (Bollivar et al., 1994b), and homologous genes have been isolated from oxygenic plants (Jensen et al., 1996). With the recent identification of 3,8-divinyl protochlorophyllide (Pchlide) a 8-vinyl reductase, all genes required for Chl biosynthesis have been identified in higher plants (Nagata et al., 2005). Analysis of the complete genome of Arabidopsis (Arabidopsis thaliana) shows that there are at least 27 genes encoding 15 enzymes involved in Chl biosynthesis from glutamyl-tRNA to Chl b (Nagata et al., 2005).
Chl synthase is believed to be bound to the thylakoid membranes and to catalyze prenylation of chlorophyllide (Chlide) with geranygeranyl diphosphate (GGPP) or phytyl diphosphate (PhyPP), the last step of Chl biosynthesis (Rüdiger et al., 1980
Mutants deficient in Chl synthesis have been identified in a number of multicellular plant species (Killough and Horlacher, 1993
The ygl1 Mutant Has Reduced Chl Accumulation and Delayed Chloroplast Development The ygl1 mutant was a spontaneous mutant isolated from indica rice ‘Zhenhui 249’, which exhibited a yellow-green leaf phenotype. The ygl1 mutant was slightly smaller than wild type throughout the developmental stage (Fig. 1, A–C ) and exhibited reduced levels of Chl a/b as well as carotenoid (Car) content (Table I ). Leaves of the ygl1 mutant had 20% to 70% reduction of Chl, and 30% to 40% reduction of Car levels compared to those in wild type at different stages, with the most significant differences detectable in 4-week-old plants. The Chl a/b ratio appeared highest at the seedling stage, due likely to the potential of Chl b synthesis in suffering a more severe decline than Chl a. The Chl a/b ratio then declined to eventually reach the wild-type level. Together this suggests that the ygl1 mutant exhibited delayed greening during photomorphogenesis because of slow rates of Chl accumulation. Eventually, mutant plants accumulated substantial quantities of Chl, reaching almost the wild-type levels and becoming slightly yellow with the maturation of leaves.
To investigate how the ygl1 mutation affects chloroplast development, we compared the ultrastructures of plastids in the ygl1 mutant and wild-type plants at different developmental stages using transmission electron microscopy. Granal stacks in the ygl1 mutant appeared less dense (Fig. 1E) and lacked granal membranes compared to those of wild type (Fig. 1D) in developing leaves. Granal development in the ygl1 mutant was slower than that of wild type, and granal membranes in the ygl1 mutant increased when the leaf became mature (data not shown).
For genetic analysis of the ygl1 mutant, four F2 populations were constructed from the crosses between the ygl1 mutant and ‘PA64’, ‘W002’, ‘USSR5’, and ‘02428’. All F1 plants from the four crosses displayed wild-type phenotype, and their F2 progenies all showed a segregation ratio of 3:1 (green:yellow-green plants,
To map the ygl1 locus, an F2 mapping population was generated from a cross between the ygl1 mutant with ‘PA64’. The ygl1 gene was mapped to an interval between markers RM516 and RM164 on chromosome 5 (Fig. 2A ). Comparison of the chromosomal locations and leaf color phenotypes indicated that ygl1 was a novel gene and different from the previously identified genes related to leaf color alteration (Nagato and Yoshimura, 1998 ). To narrow down the search for a candidate gene affected in ygl1 mutant plants, a larger F2 mapping population consisting of more than 12,000 plants, of which 2,741 segregants showed the ygl1 mutant phenotype were used for fine mapping. Three simple sequence repeat (SSR) markers and seven cleaved-amplified polymorphic sequence (CAPS) markers were developed (Table III
) between markers RM516 and RM164. The ygl1 locus was mapped to an 11-kb DNA region between the two CAPS markers P23 and P8 on a single bacterial artificial chromosome (BAC), AC136221 (Fig. 2, B and C). Within this region, two open reading frames (ORFs) were predicted using the program FGENESH 2.2 (www.softberry.com). The first ORF encoded a putative Chl synthase that shows a high similarity to the oat Chl synthase gene, an enzyme required for Chl a biosynthesis (Schmid et al., 2001). The second ORF was the Osem gene, encoding a protein similar to embryonic abundant protein. To define the molecular lesions of the ygl1 mutant, both candidate ORFs were amplified by reverse transcription (RT)-PCR from the ygl1 mutant and wild-type plants, respectively, and sequenced. Comparison of the sequences revealed that only the first ORF was altered, exhibiting a single nucleotide mutation at codon 592 (T  C) in the eighth exon, which resulted in an amino acid change from Pro-198 to Ser (Fig. 3A
). Therefore, we tentatively designated the first ORF as the YGL1 gene.
Searching the rice genome database revealed that YGL1 is a single-copy gene with a 1,131-bp ORF. The coding region of YGL1 gene is comprised of 15 exons and encodes a 376-amino acid protein with the molecular mass of approximately 41 kD. YGL1 contains an apparent chloroplast-targeting sequence of 47 amino acids at its N terminus. Multiple amino acid sequence alignments showed that YGL1 had a significant similarity to the representatives from particular classes of Chl and bacterchlorophyll synthases from different organisms (Fig. 3A). For example, YGL1 is 88.39% identical to Chl synthase from oat (Schmid et al., 2001 ), 74.68% identical to the Arabidopsis G4 gene product (Oster and Rüdiger, 1997), and 53.94% identical to the Synechocystis sp. PCC 6803 enzyme (Kaneko et al., 1995). Moreover, YGL1 is also homologous (23%–30%) to various bacteriochlorophyll synthases (Bollivar et al., 1994a, 1994b; Lopez et al., 1996; Xiong et al., 1998; Addlesee et al., 2000).
We then analyzed the possible phylogenetic relationships between YGL1 and its related proteins from higher plants and cyanobacteria (Fig. 3B). The result indicated that rice YGL1 was more closely related to Chl synthase from the monocotyledon plant oat than to those of other species. Not surprisingly, YGL1 has a phylogenetically much closer relationship to Chl synthases of the higher plant species than to bacteria proteins. In addition, it is interesting to note that bacteriochlorophyll synthases lack a motif (WAGHDF-197) that exists only in the Chl synthase (Supplemental Fig. S1). Analysis with the transmembrane calculation programs (Nilsson et al., 2002 The identity of ygl1 was subsequently confirmed by genetic complementation experiments (Fig. 4A ). The color of leaves, the levels of Chl, and the ratio of Chl a/b were all restored to levels of wild-type plants upon transformation with the YGL1 gene (Fig. 4, B and C). Therefore, this confirms that observed abnormal phenotypes of the ygl1 mutant plants resulted from mutation of the YGL1 gene.
YGL1 mRNA Expression Level Is Not Affected by the ygl1 Mutation of YGL1 We compared the level of YGL1 transcript in ygl1 mutant and wild-type plants using RT-PCR. Figure 5A showed that YGL1 mRNA was expressed at similar levels in root, leaf sheaths, leaves, and young panicles in both the ygl1 mutant and wild type. We also examined the effect of light and dark growth conditions on the expression of YGL1. No change in transcript levels was observed when ygl1 or wild-type plants were grown under light or dark conditions (Fig. 5B). Furthermore, no significant differences of YGL1 mRNA levels were observed in the mutant compared to wild type from early to mature stages (Fig. 5C). These results indicate that the missense mutation of ygl1 does not affect its own mRNA expression.
We next addressed the question of whether the ygl1 mutation affected the transcript of other genes associated with Chl biosynthesis, chloroplast development, or photosynthesis. Analysis of mRNA levels using real-time PCR showed that the expression of genes involved in Chl biosynthesis, such as glutamyl tRNA reductase (HEMA1), was reduced by about 40%, and Chlide a oxygenase1 (CAO1) and NADPH:Pchlide oxidoreductase (PORA) were slightly reduced in ygl1 mutant seedlings compared with wild type (Fig. 6 ). Interestingly, the expression of cab1R, which encodes the light-harvesting Chl a/b-binding protein of PSII (Matsuoka, 1990 ), was severely suppressed, whereas another cab gene, cab2R, showed only slightly decreased mRNA levels in the ygl1 mutant. The expression levels of plastid genes, psaA and psbA encoding two reaction center polypeptides, and rbcL encoding the large subunit of Rubisco, were not significantly reduced in the ygl1 mutant. However, the expression of the nuclear rbcS gene encoding the small subunit of Rubisco (Kyozuka et al., 1993) was slightly decreased in the ygl1 mutant (Fig. 6). Taken together, it is likely that that the ygl1 mutation affected the transcript of most nuclear genes, such as cab1R, HEMA1, CAO1, etc., but not the expression of plastid-encoded genes including psaA, psbA, and rbcL in the ygl1 mutant.
Single Amino Acid Change Causes a Reduction in Chl Synthase Activity
We then examined whether the Pro-198 to Ser amino acid substitution in ygl1 impaired enzymatic function of the ygl1 mutant. An in vitro assay was used to compare the esterification activity of the recombinant Chl synthase enzymes produced from E. coli using Chlide a along with two different substrates, GGPP and PhyPP (Oster et al., 1997
The rate of Chl accumulation was next compared in the ygl1 mutant and wild-type seedlings. The seedlings were grown in darkness for 1 week and Chl content and Chl a/b ratio were measured after exposure to white light at various times. The results showed that the rate of Chl accumulation was slower in the ygl1 mutant than in the wild type (Fig. 7B). The ratio of Chl a/b was lower in the ygl1 mutant than in wild type initially, and it became higher after 2 d. Notably, the peak value at 2 d in ygl1 mutant was substantially more than the peak value of wild type at 5 h (Fig. 7C). One possible explanation is that Chl a synthesis becomes limiting and Chl a preferentially assembles reaction centers (RCs) in the ygl1 mutant; once the RCs were no longer incorporating the majority of Chl a, Chl b was produced in significant amounts only when there was leftover Chl a (Falbel and Staehelin, 1996 ; Falbel et al., 1996). These data suggest that aberration of Chl synthase function results in decrease of Chl a synthesis in the ygl1 mutant.
When angiosperm plants were grown in dark conditions, Pchlide accumulated instead of Chl and plants had an etiolated phenotype (Schoch et al., 1977
Chl synthase has been the subject of thorough investigation (for review, see Suzuk, 1997 ; Willows, 2003). However, to our knowledge, no corresponding Chl synthase mutant has been found in higher plants. In this study, we have identified and functionally characterized the Chl synthase mutant, ygl1 of rice, at the molecular level.
Lopez et al. (1996)
In this study, the ygl1 mutant seedlings displayed a yellow-green phenotype and became green with leaf Chl accumulation at the mature stage (Table I). The Car content was significantly lower in the mutant plants compared to wild type, even in older leaves in which the Chl content was the same as wild type (Table I). This result might be related to the parallel degradation of pigments and pigment-binding proteins of the photosynthetic apparatus (Cunningham and Gantt, 1998
Mutation of the YGL1 gene reduced Chl levels and resulted in a yellow-green phenotype more or less specific to younger plants. Why the ygl1 mutation affects Chl biosynthesis most dramatically in the early developmental stage but is restored in later stages is not yet completely understood. One possible explanation is that there might be other Chl synthase homologs with redundant functional activities in later stages. However, no other rice Chl synthase genes were identified from a survey of the rice genome database (International Rice Genome Sequencing Project, 2005
Moreover, the delayed chloroplast development might lead to a slow accumulation of Chl in ygl1 mutant seedling leaves. Chl synthase was proposed to localize to the thylakoid membranes where esterification of Chlide a with phytol or earlier alcohol precursors take place (Block et al., 1980
Previous reports indicated that the transcript of the Arabidopsis G4 gene was detected only in green or greening tissues, and its expression was not strictly light dependent, while oat CHLG gene was constitutively expressed (Gaubier et al., 1995
In the ygl1 mutant, the transcript level of cab1R gene was severely impaired and markedly different from that of cab2R, which was only slightly decreased at the young seedling stage (Fig. 6), indicating that both are differentially regulated (Matsuoka, 1990
CAO was previously considered to be the only enzyme responsible for Chl b synthesis. Recombinant CAO had been shown to convert Chlide a into Chlide b, most likely by a two-step oxygenation (Oster et al., 2000
Chl a is required for the formation of photosynthetic reaction centers and light-harvesting complexes, and Chl b is exclusively located in the light-harvesting pigment protein complexes of PSI and PSII. An appropriate ratio of Chl a/b is critical in the regulation of photosynthetic antenna size (Jansson, 1994
Plant Materials
The rice (Oryza sativa) yellow-green leaf mutant (ygl1) was isolated from indica ‘Zhenhui249’. The ygl1 was crossed with ‘PA64’ to construct the F2 mapping population. ‘PA64’ has a major genetic background of indica and minor gene flows from javanica (Bao et al., 2005
Genomic DNA was extracted and analyzed for cosegregation using available SSR (McCouch et al., 2002
The full-length CHLG protein sequences were retrieved from GenBank and used for phylogenetic analysis according to the methods described by Li et al. (2003)
As Agrobacterium-mediated transformations are difficult to perform in indica rice, the ygl1 gene was also transferred to Wuyunjing 8 (spp. japonica) by five rounds of backcrosses with Wuyunjing 8 and self crossed for five generations. We obtained an isogenic line with ygl1 allele in japonica genetic background and named it as ygl2, which was used as transforming material.
For complementation of the ygl1 mutation, a full-length cDNA fragment encoding YGL1 was amplified by RT-PCR using the primers 5'-AACTGCAGAGTCTCCAATGGCCACCTC-3' and 5'-GGACTAGTGCTTTCATCAGTGGCTGGTT-3' from the wild type. The primers incorporated a PstI site at the N-terminal end and a SpeI site at the C-terminal end of the ORF. PCR products were cloned into the pMD18-T vector (TaKaRa). Then the YGL1 cDNA fragment from wild type was digested with PstI and SpeI and ligated into the PstI and SpeI sites of a binary vector pCUbi1390 (T. Lu, unpublished data) harboring a hygromycin-resistant gene. The resulting pCUYGL1 plasmid, which contained the YGL1 coding sequence driven by the ubiquitin promoter, was transformed into Agrobacterium tumefaciens strain EHA105 by electroporation, and transformed to japonica rice ygl2 for complementation testing according to a published method (Hiei et al., 1994
Total RNA was extracted from leaves, leaf sheaths, young panicles, and roots according to the method described by Wadsworth et al. (1988)
Both YGL1 and ygl1 full-length cDNAs were isolated by RT-PCR from the total RNA from ygl1 and wild-type leaves with the RT-PCR system (TaKaRa) using primer 1 (5'CGCGGATCCCAGTCTCCAATGGCCACCT3') and primer 2 (5'CCCAAGCTTTGCTTTCA TCAGTGGCTGGT3'). The primers incorporated a BamHI site at the N-terminal end and a HindIII site at the C-terminal end of the ORF. The PCR products were inserted into pMD18-T vectors and sequenced to obtain the correct clones, pMDYGL1 and pMDygl1. The pMDYGL1 and pMDygl1 plasmids were then digested and cloned into the corresponding site of the bacterial expression vector pET28-a(+) (Novagen) to generate pETYGL1 and pETygl1, sequenced to confirm YGL1 and ygl1 sequences, respectively, then introduced into Escherichia coli BL21 for protein expression. Protein expression and recombinant enzyme activity assays were according to the method as described by Schmid et al. (2001)
Total Chl and Cars were determined with DU 800 UV/Vis Spectrophotometers (Beckman Coulter) according to the method of Arnon (1949)
Wild-type and ygl1 mutant leaf samples were harvested from 1-week- and 1-month-old plants grown in a greenhouse at medium light intensity (approximately 150 µmol photons m–2 s–1). Leaf sections were fixed in a solution of 2% glutaraldehyde and further fixed in 1% OsO4. Tissues were stained with uranyl acetate, dehydrated in ethanol, and embedded in Spurr's medium prior to thin sectioning. Samples were stained again and examined with a JEOL 100 CX electron microscope. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number EF432576 (YGL1).
The following materials are available in the online version of this article.
We are grateful to Prof. Wolfhart Rüdiger and Dr. Ulrike Oster at the Botanics Institute of the University of Munich for the Chl synthase activity assay. We thank Dr. Yu Jun at the Beijing Genomics Institute at the Chinese Academy of Sciences for access to the ‘PA64s’ partial genome sequence prior to its publication. We also thank Prof. Sodmergen and Dr. Yingchun Hu at the College of Life Sciences at Peking University for their assistance in electron microscopy analysis, and Dr. Lu Tiegang at the Chinese Academy of Agricultural Sciences for providing the rice transformation vector pCUbi1390. Received April 1, 2007; accepted May 16, 2007; published May 25, 2007.
1 This work was supported by the National Key Basic Research "973" Program of China (grant nos. 2006CB1017000 and 2006CB100201), by the National "863" Program (grant no. 2006AA100101), and by the Program for Changjiang Scholars and Innovative Research Team in University. 
2 Present address: Department of Agronomy, Jiangxi Agricultural University, Nanchang 330045, China. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jianmin Wan (wanjm{at}caas.net.cn).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.100321 * Corresponding author; e-mail wanjm{at}caas.net.cn or wanjm{at}njau.edu.cn.
Addlesee HA, Fiedor L, Hunter CN (2000) Physical mapping of bchG, orf427, and orf177 in the photosynthesis gene cluster of Rhodobacter sphaeroides: functional assignment of the bacteriochlorophyll synthetase gene. J Bacteriol 182: 3175–3182 Arnon DI (1949) Copper enzymes in isolated chloroplasts: polyphenol-oxidase in Beta vulgaris. Plant Physiol 24: 1–15[Medline] Bao JY, Lee S, Chen C, Zhang XQ, Zhang Y, Liu SQ, Clark T, Wang J, Cao ML, Yang HM, et al (2005) Serial analysis of gene expression study of a hybrid rice strain (LYP9) and its parental cultivars. Plant Physiol 138: 1216–1231 Biswal UC, Biswal B, Raval MK (2003) Protoplastid to chloroplast transformation. In J Kutik, ed, Chloroplast Biogenesis. From proplastid to Gerontoplast. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 19–77 Block MA, Joyard J, Douce R (1980) Site of synthesis of geranylgeraniol derivatives in intact spinach chloroplasts. Biochim Biophys Acta 631: 210–219[Medline] Bollivar DW, Suzuki JY, Beatty JT, Dobrowolski JM, Bauer CE (1994a) Directed mutational analysis of bacteriochlorophyll a biosynthesis in Rhodobacter capsulatus. J Mol Biol 237: 622–640[CrossRef][ISI][Medline] Bollivar DW, Wang S, Allen JP, Bauer CE (1994b) Molecular genetic analysis of terminal steps in bacteriochlorophyll a biosynthesis: characterization of a Rhodobacter capsulatus strain that synthesizes geranylgeraniol-esterified bacteriochlorophyll a. Biochemistry 33: 12763–12768[CrossRef][Medline] Cunningham FX, Gantt JE (1998) Genes and enzymes of carotenoid biosynthesis in plants. Annu Rev Plant Physiol Plant Mol Biol 49: 557–583[CrossRef][ISI][Medline] Dijkwel PP, Huijser C, Weisbeek PJ, Chua NH, Smeekens SCM (1997) Sucrose control of phytochrome A signaling in Arabidopsis. Plant Cell 9: 583–595[Abstract] Eichacker LA, Paulsen H, Rüdiger W (1992) Synthesis of chlorophyll a regulates translation of chlorophyll a apoproteins P700, CP47, CP43 and D2 in barley etioplasts. Eur J Biochem 205: 17–24[ISI][Medline] Eichacker LA, Soll J, Lauterbach P, Rüdiger W, Klein RR, Mullet JE (1990) In vitro synthesis of chlorophyll a in the dark triggers accumulation of chlorophyll a apoproteins in barley etioplasts. J Biol Chem 265: 13566–13571 El-Saht HM (2000) Effects of delta-aminolevulinic acid on pigment formation and chlorophyllase activity in French bean leaf. Acta Biol Hung 51: 83–90[ISI][Medline] Falbel TG, Meehl JB, Staehelin A (1996) Severity of mutant phenotype in a series of chlorophyll-deficient wheat mutants depends on light intensity and the severity of the block in chlorophyll synthesis. Plant Physiol 112: 821–832[Abstract] Falbel TG, Staehelin LA (1996) Partial block in the early steps of the chlorophyll synthesis pathway: a common feature of chlorophyll b-deficient mutants. Plant Physiol 97: 311–320[CrossRef] Flores S, Tobin EM (1986) Cytokinin modulation of Lhcp messenger-RNA levels—the involvement of post-transcriptional regulation. Plant Mol Biol 11: 409–415 Fromme P, Melkozernov A, Jordan P, Krauss N (2003) Structure and function of photosystem I: interaction with its soluble electron carriers and external antenna systems. FEBS Lett 555: 40–44[CrossRef][ISI][Medline] Gaubier P, Hui-Ju W, Laudie M, Delseny M, Grellet F (1995) A chlorophyll synthetase gene from Arabidopsis thaliana. Mol Gen Genet 249: 58–64[CrossRef][ISI][Medline] Harper AL, von Gesjen SE, Linford A, Peterson MP, Faircloth RS, Thissen MM, Brusslan JA (2004) Chlorophyllide a oxygenase mRNA and protein levels correlate with the chlorophyll a/b ratio in Arabidopsis thaliana. Photosynth Res 79: 149–159[CrossRef][ISI][Medline] Havaux M, Tardy F (1997) Thermostability and photostability of photosystem II in leaves of the Chlorina-f2 barley mutant deficient in light-harvesting chlorophyll a/b protein complexes. Plant Physiol 113: 913–923[Abstract] Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271–282[CrossRef][ISI][Medline] Hirai A, Ishibashi T, Morikami A, Iwatsuki N, Shinozaki K, Sugiura M (1985) Rice chloroplast DNA: an oxylase and the 32 kD photosystem II reaction center protein. Theor Appl Genet 70: 117–122[ISI] International Rice Genome Sequencing Project (2005) The map-based sequence of the rice genome. Nature 436: 793–800[CrossRef][Medline] Jansson S (1994) The light-harvesting chlorophyll a/b-binding proteins. Biochim Biophys Acta 1184: 1–19[Medline] Jensen PE, Willows RD, Petersen BL, Vothknecht UC, Stummann BM, Kannangara CG, von Wettstein D, Henningsen KW (1996) Structural genes for Mg-chelatase subunits in barley: Xantha-f, -g and -h. Mol Gen Genet 250: 383–394[ISI][Medline] Kaneko T, Tanaka A, Sato S, Kotni H, Sazuka T (1995) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. I. Sequence features in the 1Mb region from map positions 64% to 92% of the genome. DNA Res 2: 153–166[Abstract] Karlin-Neumann GA, Sun L, Tobin EM (1988) Expression of light-harvesting chlorophyll a/b-protein genes is phytochrome regulated in etiolated Arabidopsis thaliana seedlings. Plant Physiol 88: 1323–1331 Killough DT, Horlacher WR (1993) The inheritance of virescent yellow and red plant colors in cotton. Genetics 18: 329–333 Kyozuka J, McElroy D, Hayakawa T, Xie Y, Wu R, Shimamoto K (1993) Light-regulated and cell-specific expression of tomato rbcS-gusA and rice rbcS-gusA fusion genes in transgenic rice. Plant Physiol 102: 991–1000[Abstract] Li Y, Qian Q, Zhou Y, Yan M, Sun L, Zhang M, Fu Z, Wang Y, Han B, Pang X (2003) BRITTLE CULM1, which encodes a COBRA-like protein, affects the mechanical properties of rice plants. Plant Cell 15: 2020–2031 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2-CT method. Methods 25: 402–408[CrossRef][ISI][Medline] Lopez JC, Ryan S, Blankenship RE (1996) Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyl transferases. J Bacteriol 178: 3363–3373 Masuda T, Fusada N, Osawa N (2003a) Functional analysis of isoforms of NADPH: protochlorophyllide oxidoreductase (POR), PORB and PORC, in Arabidopsis thaliana. Plant Cell Physiol 44: 963–974 Masuda T, Polle JEW, Melis A (2002) Biosynthesis and distribution of chlorophyll among the photosystems during recovery of the green alga Dunaliella salina from irradiance stress. Plant Physiol 128: 603–614 Masuda T, Tanaka A, Melis A (2003b) Chlorophyll antenna size adjustments by irradiance in Dunaliella salina involve coordinate regulation of chlorophyll a oxygenase (CAO) and Lhcb gene expression. Plant Mol Biol 51: 757–771[CrossRef][ISI][Medline] Matsuoka M (1990) Classification and characterization of cDNA that encodes the light-harvesting chlorophyll a/b binding protein of photosystem II from rice. Plant Cell Physiol 31: 519–526 McCouch SR, Teytelman L, Xu YB (2002) Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res 9: 199–207[Abstract] Millar AJ, Kay S (1996) Integration of circadian and phototransduction pathways in the network controlling CAB gene transcription in Arabidopsis. Proc Natl Acad Sci USA 93: 15491–15496 Mock HP, Grimm B (1997) Reduction of uroporphyrin decarboxylase by antisense RNA expression affects activities of other enzymes involved in tetrapyrrole biosynthesis and leads to light-dependent necrosis. Plant Physiol 113: 1101–1112[Abstract] Nagata N, Tanaka R, Satoh S (2005) Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus Species. Plant Cell 17: 233–240 Nagato Y, Yoshimura A (1998) Report of the committee on gene symbolization, nomenclature and linkage groups. Rice Genet Newsl 15: 34–74 Nakayashiki T, Nishimura K, Inokuchi H (1995) Cloning and sequencing of a previously unidentified gene that is involved in the biosynthesis of heme in Escherichia coli. Gene 153: 67–70[CrossRef][ISI][Medline] Narita S, Tanaka R, Ito T, Okada K, Taketani S, Inokuchi H (1996) Molecular cloning and characterization of a cDNA that encodes protoporphyrinogen oxidase of Arabidopsis thaliana. Gene 182: 169–175[CrossRef][ISI][Medline] Nielsen H, Krogh A (1998) Prediction of signal peptides and signal anchors by a hidden Markov model. In Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology (ISMB 6). Menlo Park, CA, pp 122–130 Nilsson J, Persson B, Heijne GV (2002) Prediction of partial membrane protein topologies using aconsensus approach. Protein Sci 11: 2974–2980 Oster U, Bauer CE, Rüdiger W (1997) Characterization of chlorophyll a and bacteriochlorophyll a synthases by heterologous expression in Escherichia coli. J Biol Chem 272: 9671–9676 Oster U, Rüdiger W (1997) The G4 gene of Arabidopsis thaliana encodes a chlorophyll synthase of etiolated plants. Bot Acta 110: 420–423[ISI] Oster U, Tanaka R, Tanaka A, Rüdiger W (2000) Cloning and functional expression of the gene encoding the key enzyme for chlorophyll b biosynthesis (CAO) from Arabidopsis thaliana. Plant J 21: 305–310[CrossRef][ISI][Medline] Papenbrock J, Mock HP, Tanaka R, Kruse E, Grimm B (2000) Role of magnesium chelatase activity in the early steps of the tetrapyrrole biosynthetic pathway. Plant Physiol 122: 1161–1169 Paulsen H, Rumler U, Rudiger W (1990) Reconstitution of chlorophyll pigment-containing complexes from light-harvesting chlorophyll a/b-binding protein overexpressed in Escherichia coli. Planta 181: 204–211[CrossRef][ISI] Pontoppidan B, Kannangara G (1994) Purification and partial characterization of barley glutamyl-tRNA(Glu) reductase, the enzyme that directs glutamate to chlorophyll biosynthesis. Eur J Biochem 225: 529–537[ISI][Medline] Porra RJ (1997) Recent progress in porphyrin and chlorophyll biosynthesis. Photochem Photobiol 63: 492–516[ISI] Richard AT (1975) Biochemical Spectroscopy, Vol 1. Adam Hilger Ltd, London, pp 327–330 Rüdiger W (1992) Last steps in chlorophyll biosynthesis: esterification and insertion into the membrane. In JH Argyroudi-Akoyunoglou, ed, Regulation of Chloroplast Biogenesis. Plenum Press, New York, pp 183–190 Rüdiger W (1993) Esterification of chlorophyllide and its implication on thylakoid development. In M Ryberg, C Sundqvist, eds, Pigment-Protein Complexes in Plastids: Synthesis and Assembly. Academic Press, New York, pp 219–240 Rüdiger W, Benz J, Guthoff C (1980) Detection and partial characterization of activity of chlorophyll synthetase in etioplast membranes. Eur J Biochem 109: 193–200 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
2 < 
