|
|
||||||||
|
First published online October 21, 2005; 10.1104/pp.105.070292 Plant Physiology 139:1155-1162 (2005) © 2005 American Society of Plant Biologists Identification of Three Urease Accessory Proteins That Are Required for Urease Activation in Arabidopsis1Freie Universität Berlin, Institut für Biologie, Abteilung Biochemie der Pflanzen, 14195 Berlin, Germany (C.-P.W., T.R.); and GABI-Kat at Max-Planck-Institute for Plant Breeding Research, 50829 Cologne, Germany (M.G.R.)
Urease is a nickel-containing urea hydrolase involved in nitrogen recycling from ureide, purine, and arginine catabolism in plants. The process of urease activation by incorporation of nickel into the active site is a prime example of chaperone-mediated metal transfer to an enzyme. Four urease accessory proteins are required for activation in Klebsiella aerogenes. In plants urease accessory proteins have so far been only partially defined. Using reverse genetic tools we identified four genes that are necessary for urease activity in Arabidopsis (Arabidopsis thaliana; ecotypes Columbia and Nössen). Plants bearing T-DNA or Ds element insertions in either the structural gene for urease or in any of the three putative urease accessory genes AtureD, AtureF, and AtureG lacked the corresponding mRNAs and were defective in urease activity. In contrast to wild-type plants, the mutant lines were not able to support growth with urea as the sole nitrogen source. To investigate whether the identified accessory proteins would be sufficient to support eukaryotic urease activation, the corresponding cDNAs were introduced into urease-negative Escherichia coli. In these bacteria, urease activity was observed only when all three plant accessory genes were coexpressed together with the plant urease gene. Remarkably, plant urease activation occurred as well in cell-free E. coli extracts, but only in extracts from cells that had expressed all three accessory proteins. The future molecular dissection of the plant urease activation process may therefore be performed in vitro, providing a powerful tool to further our understanding of the biochemistry of chaperone-mediated metal transfer processes in plants.
The first step of the hydrolysis of urea to ammonium and carbonic acid is catalyzed by the nickel metalloenzyme urease, which is found in many microbes (Mulrooney and Hausinger, 2003
Activation of urease is best studied in Klebsiella aerogenes. It requires the carbamoylation of a Lys residue and the incorporation of two nickel ions per active site (Kuchar and Hausinger, 2004
Prokaryotic ureases are mostly encoded by three genes that are collinearly fused to one gene in eukaryotes (Mulrooney and Hausinger, 2003
A function for the putative plant urease accessory proteins in plant urease activation has so far been demonstrated only for an UreG ortholog from soybean. A mutation in the corresponding gene Eu3 eliminated both urease activities of this plant (Freyermuth et al., 2000 Here we report that Arabidopsis null mutants of the genes encoding At2g35035, At1g21840, and At2g34470 lack urease activity in vivo, identifying these proteins as genuine urease accessory proteins AtUreD, AtUreF, and AtUreG. Simultaneous coexpression of Aturease, AtUreD, AtUreF, and AtUreG in Escherichia coli led to activation of plant urease in bacterial cells and in cell-free extracts, showing that these proteins are the core components for plant urease activation.
Isolation of Mutants
Using the insertion mutant collections of the Salk Institute Genomic Analysis Laboratory (Alonso et al., 2003
All four genes are single copy in Col; the copy numbers in Nössen are unknown. The positions of the insertions were confirmed by sequencing the PCR products amplified with a primer binding to the left border of the T-DNA or the G-side of the Ds element in combination with a gene-specific primer, respectively (see "Materials and Methods"). Except for mutant lines ureD-2 and ureG-2, the insertions had occurred in exons, likely preventing the generation of an intact mRNA. The insertion in ureD-2 was found in intron 1 8 bp downstream of the intron-exon boundary, possibly compromising correct splicing. In ureG-2 the T-DNA inserted exactly at the boundary of exon 3 to intron 4, eliminating the 5' splice site of intron 4. The ureF gene encodes a protein of 240 amino acids and does not contain introns. In both ureF mutants the reading frame is truncated and altered at the 3' end. UreF-1 encodes a protein of 217 amino acids, the C-terminal 17 amino acids being altered, and ureF-2 encodes a 190-amino acid protein with two changed residues at the C terminus. None of the mutants displayed a visible phenotype under standard growth conditions used for Arabidopsis (see "Materials and Methods").
Insertion mutants were characterized by reverse transcription (RT)-PCR experiments testing for the presence and integrity of mRNA transcribed from the genes affected by the insertions. For each mutant two primer pairs were used, one spanning the insertion and one in an unaltered region of the gene but always spanning an intron where possible (Fig. 1). To test the RT reactions, control PCRs with primers for actin 2 (At3g18780) were carried out (Fig. 2D). Control reactions without RT to test for the presence of genomic DNA were negative in all cases (Fig. 2B, lanes 712; data not shown). Reactions were repeated at least twice.
These experiments demonstrated that all mutants lacked an intact wild-type mRNA for the respective mutant gene. In detail, for none of the mutants except ureG-1 an RT-PCR product was obtained with primers spanning the insertion (lanes marked "s" in Fig. 2), while the corresponding wild-type controls were positive yielding products of the expected size (for expected product sizes see Fig. 1). With RNA from ureG-1 plants, a product of reduced length was obtained, possibly because the corresponding template in this mutant is subject to aberrant splicing due to the insertion (Fig. 2A, lane 8). With the primer pairs binding in unaltered regions of the respective genes, RT-PCR products were obtained in all cases albeit in strongly reduced amounts for ureF-1, ureF-2, and ureG-3 (Fig. 2C, lanes 3, 5, and 9). For ureG-1 the obtained product was of increased size (Fig. 2A, lane 7) again arguing for altered splicing of the template in this mutant. Also, for ureG-2 splicing may be partially affected (lane 9). UreD transcript was previously described to be alternatively spliced in part leading to the incorporation of a stop codon exactly 3' of exon 4 (Fig. 1B, black triangle; accession no. AJ312203; Witte, 2001
All mutant plants were unable to sustain growth on urea as sole nitrogen source (Fig. 3). In contrast, both wild-type accessions grew well either with nitrate or with urea. This experiment was repeated three times with identical results.
For urease activity quantification, protein extracts were prepared from pooled leaves of four to five plants for each line, respectively. The plants were grown on soil supplemented with NiCl2 to allow efficient urease activation. For the wild-type plants, leaf urease activities of 13.5 ± 0.7 mU mg1 (Nössen Ds donor line DS5-392-12) and 17.9 ± 1.6 mU mg1 (Col 0) were determined (errors are confidence intervals for P = 95%). Comparable activities were reported from leaves of other plants (Witte and Medina-Escobar, 2001 These findings demonstrate that the Arabidopsis urease accessory proteins AtUreD, AtUreF, and AtUreG are required in vivo to generate a functional urease enzyme.
To investigate whether AtUreD, AtUreF, and AtUreG are not only necessary but also sufficient for plant urease activation at least in a heterologous system, we coexpressed these accessory proteins together with Aturease in E. coli and measured urease activity in bacterial extracts. While some Enterobacteria like K. aerogenes contain a urease operon and are urease positive, E. coli generally does not possess ureolytic activity (Mobley et al., 1995 When Aturease and all three Arabidopsis accessory proteins were simultaneously expressed, ureolytic activity was observed in E. coli extracts. Lack of AtureD, AtureF, or AtureG eliminated urease activation in this system (Fig. 4A). Presence of the corresponding mRNAs was shown by RT-PCR (Fig. 4B). Thus, the three accessory proteins are not only necessary but also comprise the core components required for the activation of plant urease. Replacing ureD with the alternative splice variant ureD* (stop codon directly 3' of exon 4; Fig. 1) also led to urease activation but again only in the presence of the other accessory proteins.
If the activation occurred only inside the E. coli cells but not after extraction, a constant activity would be measured in the extract. This appeared to be the case in the presence of truncated ureD* where a linear increase of ammonium concentration was observed in the assay (Fig. 4A). Alternatively, if the activation occurred in the cells but continued after extraction in vitro, the activity would be expected to increase during the enzyme assay. This was observed in the presence of the full-length ureD gene. To confirm that the nonlinear increase of ammonium production was in fact due to in vitro urease activation, an experiment combining different E. coli extracts was performed. Extracts of cells that had expressed urease in combination with UreF and UreG (1), or UreD and UreG (2), or UreD and UreF (3) did not display activity, whereas the combined extracts of (1) and (3) or (2) and (3) allowed urease activation in vitro (Fig. 5). These experiments also provided a control showing that yellow fluorescent protein (YFP), which was always present when one of the accessory proteins was missing (see "Materials and Methods"), did not interfere with urease activation. Interestingly, combining extracts (1) and (2) did not lead to in vitro urease activation (Fig. 5). If either UreF or UreD had been lacking in the cell, extracts were not competent for in vitro urease activation even if extracts from cells that had expressed the missing protein were added.
Urease allows plants to recycle urea-nitrogen originating from Arg breakdown and purine or ureide catabolism. Since nitrogen availability is generally growth limiting for plants (Bray, 1983
Comparing accessory protein sequences from Arabidopsis and K. aerogenes shows that UreG is conserved best (42.8% identity) while UreD and UreF are only 21.8% and 19.4% identical, respectively. However, structural conservation of urease accessory proteins UreF from soybean and UreG from potato is sufficient to allow partial complementation of defective S. pombe and K. aerogenes urease activation complexes, respectively (Witte, 2001
In K. aerogenes UreD and UreF form a stable complex with apo-urease, to which UreG associates more weakly and UreE binds only transiently (Soriano and Hausinger, 1999
An alternatively spliced variant of AtureD mRNA incorporating a premature stop codon directly 3' of exon 4 has been described (accession no. AJ312203; Witte, 2001
Arabidopsis UreD, UreF, and UreG are necessary and sufficient to activate Aturease in E. coli. In planta further proteins may be required. The soybean mutant Eu2 eliminates both urease activities of this plant (Meyer-Bothling et al., 1987 The possibility to assemble a functional plant urease in a heterologous system and in vitro will allow a detailed biochemical analysis of the plant (eukaryotic) urease activation process. Great advances in understanding this process using the urease operon of K. aerogenes expressed in E. coli have been made, but the precise function of the urease accessory proteins remains in the dark. The comparison of the prokaryotic to the eukaryotic urease activation system may further our understanding of protein-mediated metal transfer processes.
Plant Material and Growth Conditions
Mutants of Arabidopsis (Arabidopsis thaliana) from the Salk Institute collection (Alonso et al., 2003
Agar plates were prepared with half-strength Murashige and Skoog nutrients without vitamins, sugars, or amino acids. Ammonium nitrate was omitted and cobalt chloride was replaced by 0.5 µM nickel chloride (Witte et al., 2002b
Mutants from the Salk Institute and the GABI-Kat collections were screened with a primer binding at the left border of the T-DNA insert (TGGACCGCTTGCTGCAAC for the Salk Institute collection and ATATTGACCATCATACTCATTGC for GABI-Kat). For transposon mutants from RIKEN a primer binding at the G-side of the Ds element was used: TACCTCGGGTTCGAAATC. The following gene-specific primers were used, respectively: for urease, primer u5: ATCCTCTAGTCTAACAACATTG; for ureD-1, primer d1: ATGGCGACAGGGAAAG; for ureD-2, primer d2: TTGATCCTATTGCCTTGTACAC; for both ureF mutants, primer f1: ATGGAAGAAGACGAAAG; and for all ureG mutants, primer g5: CTAGTTCTCTACTGAAATTAGCAG (Fig. 1). The PCR products from the mutants were cloned and sequenced to confirm the position of the insertions (Table I).
RNA from plants was prepared using TRI reagent (Sigma) and treated with DNaseI (Sigma) following the manufacturer's instructions. RT using 1.0 µg total RNA was performed with Moloney murine leukemia virus reverse transcriptase (Invitrogen) and a poly-T primer. PCR reactions employed the following primers (see Fig. 1): for urease: u1 + u2 (GACAGCTGACAAGATGAAG; CTCCTTTGATTATCATTTCTG) and u3 + u4 (GTGATATCAAGACCTATGTTTG; AAAGAGGAAATAGTTCCG); for ureD: d1 + d2 (see above) and d3 + d4 (CTCTTTTGGTTGTGATACCAG; TGATAGTCTTGCATCCGTTC); for ureF: f1 + f2 (above; TGTCTCTATATCAGGAGATTTG) and f3 + f4 (CTTGTATGTGGTTTACTCG; AGAGCAAAACAGTCTAGAAAACAAG); for ureG: g1 + g2 (ATGGCATCACACGACCAC; GCCAATACCGACGGTAAAAG) and g3 + g4 (CTTTTACCGTCGGTATTGGC; CACCGGATTCACAAAGAAGC); and for actin 2 (At3g18780): a1 + a2 (GTGAACGATTCCTGGACCTGCCTC; GAGAGGTTACATGTTCACCACAAC), spanning an intron. For urease, ureF, and ureG, a PCR of 35 cycles (50°C annealing temperature) was performed, while for actin 2 only 30 cycles were used. For ureD a reaction with 40 cycles (55°C annealing temperature) was carried out. RNA from Escherichia coli was extracted with TRI reagent from a cell pellet of 1 mL culture (optical density = 0.8) two hours after iso-propyl-thiogalactoside (IPTG) induction. RNA was treated with DNaseI following the manufacturer's instructions. Four-tenths of a microgram of RNA was used in the RT reaction with Moloney murine leukemia virus reverse transcriptase employing the gene-specific primers u2, d2, f2, and g2, respectively. The RT reaction was diluted 20 times in the PCR reactions that contained the primer pairs u1 + u2, d1 + d2, f1 + f2, and g1 + g2 (24 cycles; 50°C annealing temperature). Control RT-PCR reactions were carried out without adding reverse transcriptase.
Homozygous mutant plants and controls were grown on turf-based compost (Mini Tray; Balster Einheitserdewerk) in a controlled-climate chamber (8 h light of 150 µmol m2 s1, 22°C day, 18°C night, 60% relative humidity). The compost was supplemented twice during growth with 5 mL 1 mM NiCl2 per plant. The second supplement was given 1 week before the experiment to ensure optimal activation of urease.
Four-tenths of a gram of leaf material from 6-week-old plants was pooled from leaves of four to five plants of each line, and proteins were extracted with 2.5 mL sodium phosphate buffer (50 mM, pH 7.5) containing 50 mM NaCl, 1 mM EDTA, 0.1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride, and 5 mM dithiothreitol. Extracts were centrifuged (20,000 g; 15 min; 4°C), and 1.5 mL of the supernatants were passed through a 5-mL HiTrap G25 desalting gel filtration column (GE Biosciences) equilibrated with half-strength extraction buffer without 4-(2-aminoethyl)benzenesulfonyl fluoride and dithiothreitol. Desalted extracts were subjected to urease assay as described previously (Witte and Medina-Escobar, 2001
Urease from Arabidopsis was amplified by RT-PCR from leaf RNA introducing an NdeI site at the start codon and a SmaI site directly 3' of the stop codon. The urease was cloned into a derivate of the pET30 expression vector (Novagen, Merck) denominated pET30-CTH (Glinski et al., 2003
For expression, 20 mL E. coli cultures (Luria-Bertani medium) supplemented with 100 µM NiCl2 were grown at 30°C to an optical density of 0.6 and induced with 1 mM IPTG for two hours. Cells were washed twice with 20 mL 25 mM phosphate buffer (pH 7.5) containing 25 mM NaCl and 0.5 mM EDTA and finally resuspended in 1.5 mL of this buffer. Cells were ruptured by sonification and urease assays were performed with the clarified extracts at 50°C in the presence of 50 mM urea (Witte and Medina-Escobar, 2001 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers NM_105422 for the urease gene, NM_179908 for the ureD gene, NM_102032 for the ureF gene, and NM_128999 for the ureG gene.
We would like to thank the Salk Institute, GABI-Kat, and RIKEN mutant collections for providing insertion mutants of Arabidopsis, and Renate Grübnau and Gabriele Erzigkeit for technical assistance. Received August 24, 2005; returned for revision September 15, 2005; accepted September 19, 2005.
1 This work was supported by the Program for Investment in the Future from the German Ministry of Education and Science and the Alexander von Humboldt Foundation. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Claus-Peter Witte (cpwitte{at}zedat.fu-berlin.de). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.070292. * Corresponding author; e-mail cpwitte{at}zedat.fu-berlin.de; fax 493083853372.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653657 Bacanamwo M, Witte CP, Lubbers MW, Polacco JC (2002) Activation of the urease of Schizosaccharomyces pombe by the UreF accessory protein from soybean. Mol Genet Genomics 268: 525534[CrossRef][ISI][Medline] Bray CM (1983) Nitrogen Metabolism in Plants. Longman, New York
Chang ZZ, Kuchar J, Hausinger RP (2004) Chemical cross-linking and mass spectrometric identification of sites of interaction for UreD, UreF, and urease. J Biol Chem 279: 1530515313 Frankenberger W, Tabatabai M (1982) Amidase and urease activities in plants. Plant Soil 64: 153166[CrossRef] Freyermuth SK, Bacanamwo M, Polacco JC (2000) The soybean Eu3 gene encodes an Ni-binding protein necessary for urease activity. Plant J 21: 5360[CrossRef][ISI][Medline] Glinski M, Romeis T, Witte CP, Wienkoop S, Weckwerth W (2003) Stable isotope labeling of phosphopeptides for multiparallel kinase target analysis and identification of phosphorylation sites. Rapid Commun Mass Spectrom 17: 15791584[CrossRef][Medline]
Goldraij A, Polacco JC (1999) Arginase is inoperative in developing soybean embryos. Plant Physiol 119: 297303
Holland MA, Polacco JC (1992) Urease-null and hydrogenase-null phenotypes of a phylloplane bacterium reveal altered nickel metabolism in two soybean mutants. Plant Physiol 98: 942948 Kuchar J, Hausinger RP (2004) Biosynthesis of metal sites. Chem Rev 104: 509525[CrossRef][Medline] Kuromori T, Hirayama T, Kiyosue Y, Takabe H, Mizukado S, Sakurai T, Akiyama K, Kamiya A, Ito T, Shinozaki K (2004) A collection of 11,800 single-copy Ds transposon insertion lines in Arabidopsis. Plant J 37: 897905[CrossRef][ISI][Medline] Meyer-Bothling LE, Polacco JC (1987) Mutational analysis of the embryo-specific urease locus of soybean. Mol Gen Genet 209: 439444[CrossRef][Medline] Meyer-Bothling LE, Polacco JC, Cianzio SR (1987) Pleiotropic soybean mutants defective in both urease isozymes. Mol Gen Genet 209: 432438[CrossRef][Medline]
Mobley HLT, Island MD, Hausinger RP (1995) Molecular-biology of microbial ureases. Microbiol Rev 59: 451480
Moncrief MBC, Hausinger RP (1996) Purification and activation properties of UreD-UreF-urease apoprotein complexes. J Bacteriol 178: 54175421 Mulrooney SB, Hausinger RP (2003) Nickel uptake and utilization by microorganisms. FEMS Microbiol Rev 27: 239261[CrossRef][ISI][Medline]
Park IS, Carr MB, Hausinger RP (1994) In vitro activation of urease apoprotein and role of urea as a chaperone required for nickel metallocenter assembly. Proc Natl Acad Sci USA 91: 32333237
Park IS, Hausinger RP (1995) Evidence for the presence of urease apoprotein complexes containing UreD, UreF, and UreG in cells that are competent for in vivo enzyme activation. J Bacteriol 177: 19471951 Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B (2003) An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53: 247259[CrossRef][ISI][Medline] Shah K, Gadella TW, van Erp H, Hecht V, de Vries SC (2001) Subcellular localization and oligomerization of the Arabidopsis thaliana somatic embryogenesis receptor kinase 1 protein. J Mol Biol 309: 641655[CrossRef][ISI][Medline] Soriano A, Colpas GJ, Hausinger RP (2000) UreE stimulation of GTP-dependent urease activation in the UreD-UreF-UreG-urease apoprotein complex. Biochemistry 39: 1243512440[CrossRef][Medline]
Soriano A, Hausinger RP (1999) GTP-dependent activation of urease apoprotein in complex with the UreD, UreF, and UreG accessory proteins. Proc Natl Acad Sci USA 96: 1114011144 Stebbins NE, Polacco JC (1995) Urease is not essential for ureide degradation in soybean. Plant Physiol 109: 169175[Abstract]
Todd CD, Polacco JC (2004) Soybean cultivars "Williams 82" and "Maple Arrow" produce both urea and ammonia during ureide degradation. J Exp Bot 55: 867877 Torisky RS, Griffin JD, Yenofsky RL, Polacco JC (1994) A single-gene (Eu4) encodes the tissue-ubiquitous urease of soybean. Mol Gen Genet 242: 404414[Medline] Witte CP (2001) Modifying nitrogen use efficiency: molecular manipulation of urea metabolism in leaves of Solanum tuberosum. PhD thesis. Scottish Crop Research Institute, University of Dundee, Dundee, UK Witte CP, Isidore E, Tiller SA, Davies HV, Taylor MA (2001) Functional characterisation of urease accessory protein G (ureG) from potato. Plant Mol Biol 45: 169179[CrossRef][ISI][Medline] Witte CP, Medina-Escobar N (2001) In-gel detection of urease with nitroblue tetrazolium and quantification of the enzyme from different crop plants using the indophenol reaction. Anal Biochem 290: 102107[CrossRef][ISI][Medline]
Witte CP, Tiller S, Isidore E, Davies HV, Taylor MA (2005) Analysis of two alleles of the urease gene from potato: polymorphisms, expression, and extensive alternative splicing of the corresponding mRNA. J Exp Bot 56: 9199
Witte CP, Tiller SA, Taylor MA, Davies HV (2002a) Leaf urea metabolism in potato: urease activity profile and patterns of recovery and distribution of N-15 after foliar urea application in wild-type and urease-antisense transgenics. Plant Physiol 128: 11291136 Witte CP, Tiller SA, Taylor MA, Davies HV (2002b) Addition of nickel to Murashige and Skoog medium in plant tissue culture activates urease and may reduce metabolic stress. Plant Cell Tiss Organ Cult 68: 103104
Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick AM, Wu HC, Kim C, Nguyen M, et al (2003) Empirical analysis of transcriptional activity in the Arabidopsis genome. Science 302: 842846 Zonia LE, Stebbins NE, Polacco JC (1995) Essential role of urease in germination of nitrogen-limited Arabidopsis thaliana seeds. Plant Physiol 107: 10971103[Abstract] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|