Plant Physiol. email content delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 29, 2005; 10.1104/pp.104.058917

Plant Physiology 138:2233-2244 (2005)
© 2005 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
138/4/2233    most recent
pp.104.058917v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dixon, D. P.
Right arrow Articles by Edwards, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dixon, D. P.
Right arrow Articles by Edwards, R.
Agricola
Right arrow Articles by Dixon, D. P.
Right arrow Articles by Edwards, R.
Related Collections
Right arrow Reactive Oxygen Species
BIOCHEMICAL PROCESSES AND MACROMOLECULAR STRUCTURES

Stress-Induced Protein S-Glutathionylation in Arabidopsis1

David P. Dixon2, Mark Skipsey2, Nicholas M. Grundy3 and Robert Edwards*

School of Biological and Biomedical Sciences, University of Durham, Durham DH1 3LE, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
S-Glutathionylation (thiolation) is a ubiquitous redox-sensitive and reversible modification of protein cysteinyl residues that can directly regulate their activity. While well established in animals, little is known about the formation and function of these mixed disulfides in plants. After labeling the intracellular glutathione pool with [35S]cysteine, suspension cultures of Arabidopsis (Arabidopsis thaliana ecotype Columbia) were shown to undergo a large increase in protein thiolation following treatment with the oxidant tert-butylhydroperoxide. To identify proteins undergoing thiolation, a combination of in vivo and in vitro labeling methods utilizing biotinylated, oxidized glutathione (GSSG-biotin) was developed to isolate Arabidopsis proteins/protein complexes that can be reversibly glutathionylated. Following two-dimensional polyacrylamide gel electrophoresis and matrix-assisted laser desorption/ionization time of flight mass spectrometry proteomics, a total of 79 polypeptides were identified, representing a mixture of proteins that underwent direct thiolation as well as proteins complexed with thiolated polypeptides. The mechanism of thiolation of five proteins, dehydroascorbate reductase (AtDHAR1), zeta-class glutathione transferase (AtGSTZ1), nitrilase (AtNit1), alcohol dehydrogenase (AtADH1), and methionine synthase (AtMetS), was studied using the respective purified recombinant proteins. AtDHAR1, AtGSTZ1, and to a lesser degree AtNit1 underwent spontaneous thiolation with GSSG-biotin through modification of active-site cysteines. The thiolation of AtADH1 and AtMetS required the presence of unidentified Arabidopsis proteins, with this activity being inhibited by S-modifying agents. The potential role of thiolation in regulating metabolism in Arabidopsis is discussed and compared with other known redox regulatory systems operating in plants.


The tripeptide glutathione (GSH; {gamma}-Glu-Cys-Gly) serves important functions in plants as a reductant, transiently accumulating under stress conditions as its oxidized disulfide (GSSG). As well as forming disulfides with itself, GSH can also form mixed disulfides with proteinaceous Cys. This S-glutathionylation of proteins is commonly termed thiolation and has recently become established as a widespread reversible posttranslational modification of proteins that occurs in animal and fungal cells exposed to oxidative stress (Klatt and Lamas, 2000Go). Although originally considered to be a protective mechanism to prevent the irreversible oxidation of reactive protein-bound Cys to their sulfinic and sulfonic acid derivatives, it is now recognized that thiolation can act as a redox-driven regulator of signal transduction cascades and metabolic pathways (Fratelli et al., 2004Go). As such, thiolation has clear parallels with redox regulation of proteins mediated through intramolecular or intermolecular disulfide formation with other proteinaceous Cys (Lee et al., 2004Go). In plants, proteomic approaches have focused upon the redox regulation of proteins forming protein disulfides with thioredoxin in differing subcellular compartments (Motohashi et al., 2001Go; Balmer et al., 2003Go, 2004Go; Marchand et al., 2004Go; Yamazaki et al., 2004Go). The total redox-responsive disulfide proteome of Arabidopsis (Arabidopsis thaliana) has also recently been investigated using large-scale proteomic techniques (Lee et al., 2004Go). However, few studies have focused specifically on the ability of proteins to form mixed protein disulfides with GSH and how this modification may regulate their activity. Ito et al. (2003)Go fed a biotinylated glutathione ester to Arabidopsis cell cultures and reported that some 20 proteins underwent thiolation, though only two of these polypeptides were subsequently identified by sequencing, highlighting the difficulties of working in vivo.

In view of the unique oxidative stresses placed on plants, we were interested in exploring the thiolation of the Arabidopsis proteome, in particular comparing and contrasting the results obtained with those studies directed at the redox regulation of Arabidopsis proteins either by thioredoxin or by the reduction of intramolecular disulfides. To this end, we now report on an efficient in vitro method to systematically identify Arabidopsis polypeptides that are capable of undergoing rapid S-glutathionylation and the effect of this modification on the activity of specific thiolated proteins.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

In Vivo Thiolation of Arabidopsis Proteins

Arabidopsis suspension cultures treated with a chemical oxidant were used as a classic system to perturb GSH metabolism and induce oxidative stress in a large mass of plant cells (May and Leaver, 1993Go). Using 1 mM tert-butylhydroperoxide (BHP) as the oxidant, within 8 h total GSH content was increased from 250 ± 10 nmol g (fresh weight)–1 to 500 ± 130 nmol g–1, confirming the imposition of redox stress (May and Leaver, 1993Go). While it proved to be straightforward to measure soluble GSH content, the direct analysis of bound thiols proved to be difficult using S-bimane derivatization due to the large amounts of protein required. To overcome this, the cells were labeled with [35S]Cys in the presence of cycloheximide to limit incorporation of the radiolabel into de novo synthesized protein synthesis and to direct the thiol instead into GSH biosynthesis (Fratelli et al., 2002Go). The use of [35S]GSH in protein thiolation could then be monitored in response to BHP treatment by monitoring the increase in radioactivity released from extracted protein after treating with dithiothreitol (DTT) to cleave the mixed disulfides present (Fig. 1). For each determination, the identity of the released radioactivity as [35S]GSH was confirmed by radio-HPLC analysis of the respective S-bimane derivatives. Levels of protein-disulfide-bound GSH increased markedly after BHP treatment, confirming that protein thiolation was occurring. It could be calculated that within 4 h of treatment with BHP, 4.3% of the total pool of GSH was protein bound as compared with only 1.1% in the untreated cells. To monitor which proteins were being thiolated, the radiolabeled polypeptides present were analyzed by fluorography after SDS-PAGE under nonreducing conditions to avoid disulfide cleavage. This analysis showed an increase in [35S]-labeling through thiolation of a large number of polypeptides (data not shown). However, due to the relatively low levels of incorporation, attempts to directly isolate individual radiolabeled polypeptides for proteomic analysis following two-dimensional PAGE (2D-PAGE) proved unsuccessful. Instead, it was decided to feed cell cultures with a biotinylated glutathione derivative and then identify the proteins thiolated in planta using streptavidin to pull down the biotinylated disulfides, in an analogous manner to that described recently (Ito et al., 2003Go).



View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. Protein-bound [35S]GSH in Arabidopsis cell cultures following 0- to 4-h treatment with water (Control) or 1 mM BHP. Arabidopsis cell cultures were prelabeled with 25 µCi L-[35S]Cys in the presence of cycloheximide for 4 h, then the protein-bound radioactive GSH content of each sample was determined by radio-HPLC at various times after treatment. Values are the average of duplicate experiments with the error bars showing the variation in the replicates.

 

Identification of in Vivo Thiolated Proteins

Biotinylated, oxidized glutathione (GSSG-biotin) was prepared such that each GSH molecule was linked via its free amino group to biotin. Arabidopsis suspension cultures were then treated with the GSSG-biotin for 1 h followed by a 30-min oxidizing treatment with BHP, and biotinylated proteins present were purified using streptavidin-agarose. Proteins attached to the matrix by association with the biotinylated glutathione tag were selectively released using DTT to cleave the disulfides and then analyzed by 2D-PAGE (Fig. 2). The most abundant polypeptides were then identified by peptide mass fingerprinting (Table I). Eight protein families could be identified, though most of the polypeptides examined were derived from either {beta}-tubulin or Suc synthase. Since many of the polypeptides identified were smaller than expected, this suggested that the GSSG-biotin/BHP feeding study had elicited large-scale proteolysis. To extend these thiolation studies with GSSG-biotin using conditions that would not induce protein degradation, a more sensitive in vitro labeling system was developed. This had the additional benefit of increasing the likelihood of identifying a more comprehensive range of proteins undergoing thiolation since in the in vivo system it was likely that many proteins may already have been disulfide modified prior to treatment with GSSG-biotin.



View larger version (106K):
[in this window]
[in a new window]
 
Figure 2. Silver-stained 2D-PAGE of in vivo thiolated (using GSSG-biotin) proteins from Arabidopsis cell culture extracts. Labeled arrows indicate locations of identified polypeptides, whereas spots that were picked but gave insufficient data for unambiguous identification are not labeled. Approximate mass (in kilodaltons) and pI range are shown.

 

View this table:
[in this window]
[in a new window]
 
Table I. Summary of in vivo thiolated polypeptides identified by MALDI-TOF-MS-based peptide mass fingerprinting following 2D-PAGE

Spot IDs correspond to labels on Figure 2. MOWSE scores are shown, with scores greater than 60 corresponding to hits with low probability (P < 0.05) of occurring by chance, and accessions are listed.

 

Identification of in Vitro Thiolated Proteins

Proteins were thiolated in vitro with GSSG-biotin and then directly purified using streptavidin-agarose. To confirm that the derivatization with biotin did not affect the ability of GSH to form disulfides, the GSSG-biotin was incubated with freshly reduced Arabidopsis dehydroascorbate reductase 1 (AtDHAR1), a plant enzyme known to undergo S-glutathionylation through a single highly reactive Cys residue (Dixon et al., 2002Go). When analyzed by electrospray ionization mass spectrometry (ESI-MS), the AtDHAR1 (parent mass 24,561 D) was found to have been modified (mass increase of 758 D), equivalent to covalent modification with a single molecule of biotinylated GSH (GS-biotin; Fig. 3). Derivatization was found to proceed with similar efficiency to that determined using GSSG alone (Dixon et al., 2002Go), and no other adducts were observed by ESI-MS confirming selective labeling by disulfide bond formation. Crude protein extracts were then prepared from Arabidopsis plants and cell cultures and treated with GSSG-biotin after reduction with DTT. It was immediately apparent from streptavidin-probed blots of SDS-PAGE-resolved polypeptides that suspension cultures were the optimal source for labeling, with interference encountered in leaf samples due to the large amounts of Rubisco protein present (data not shown). Using extracts from the suspension cultures, thiolated proteins were affinity purified using their biotin tags and subjected to 2D-PAGE in duplicate (Fig. 4A). From the two gels, a total of 132 spots were chosen for peptide mass fingerprinting by matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) MS, of which 67 different polypeptides could be identified from their MOWSE scores with a high degree of certainty (Table II). As a control, 2D-PAGE of a similarly processed reaction prepared utilizing GSSG rather than GSSG-biotin yielded only a few minor protein spots. One polypeptide (14 kD, pI approximately pH 5.5) was identified in both control and treated samples but was subsequently identified as streptavidin that had leached from the affinity matrix.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Deconvoluted mass spectra of fully reduced AtDHAR1 before (gray line) and after (black line) modification with GSSG-biotin, showing quantitative addition of a 758-D adduct corresponding to biotinylated glutathione.

 


View larger version (99K):
[in this window]
[in a new window]
 
Figure 4. Two-dimensional PAGE of thiolated proteins from Arabidopsis cell culture extracts. Proteins and protein complexes labeled with GSSG-biotin were retained on a streptavidin matrix, with thiolated proteins then released from the column with a single treatment of DTT (A) or first washed with 6 M urea then released with DTT (B). Labeled arrows indicate locations of identified polypeptides, whereas spots that were picked but gave insufficient data for unambiguous identification are not labeled. Approximate mass (in kilodaltons) and pI range are shown. Gel analyses were performed in duplicate.

 

View this table:
[in this window]
[in a new window]
 
Table II. Summary of thiolated polypeptides identified by MALDI-TOF-MS-based peptide mass fingerprinting following 2D-PAGE

Spot IDs correspond to labels on Figure 4. MOWSE scores are shown, with scores greater than 60 corresponding to hits with low probability (P < 0.05) of occurring by chance, and accessions are listed. –, Not an Arabidopsis protein.

 
Naturally biotinylated proteins were not present in the affinity-purified sample, as they would not have been released from the streptavidin matrix under the gentle, reducing conditions used for elution of the disulfide-bound proteins. However, the method used could not discriminate between proteins that were thiolated directly from those proteins that were present in the final preparation due to their close interaction with GS-biotin-tagged proteins. To test this possibility, an additional purification step was carried out, in which the proteins bound to the streptavidin matrix were washed with 6 M urea to disrupt protein-protein interactions. The remaining disulfide-bound proteins were then eluted with DTT and analyzed by 2D-PAGE (Fig. 4B). This additional wash substantially reduced the yield of recovered protein and also considerably altered the pattern of proteins obtained. Peptide mass fingerprinting identified 22 proteins from this sample, of which six had not been picked from the previous gels (Table II).


Characterization of Proteins Targeted for Thiolation

Having identified Arabidopsis proteins that underwent thiolation in vitro, it was then of interest to determine the associated mechanism of this derivatization and its effect on protein function. Individual proteins were cloned and expressed in Escherichia coli as His-tagged polypeptides, and the purified recombinant proteins incubated with GSSG to promote thiolation were then analyzed by ESI-MS. One of the proteins identified as being thiolated in the in vitro screen was AtDHAR1 (spot ID 26) that had already been shown to undergo quantitative thiolation with a single molecule of GSH (Fig. 3), at the site of the catalytic Cys-20 (Dixon et al., 2002Go). Another protein that had been characterized previously by our group (Thom et al., 2001Go), though not due to its susceptibility to thiolation, was the zeta-class glutathione transferase 1 (AtGSTZ1; spot ID 25). In the presence of GSSG, AtGSTZ1 showed 90% conversion to a singly thiolated species, with a small (approximately 10%) proportion becoming doubly thiolated (Fig. 5). Again, we had determined previously that AtGSTZ1 contains an active-site Cys residue (Cys-19) that plays a role in the catalytic mechanism of this enzyme (Thom et al., 2001Go). As we had previously generated the AtGSTZ1-C19S mutant, it was possible to test whether this residue was the target for thiolation. When incubated with GSSG under identical conditions to those used with the wild-type enzyme, only 35% of the mutant enzyme was thiolated, confirming that the major site for mixed disulfide formation was Cys-19. The other proteins selected for individual analysis were Met synthase (AtMetS; spot ID 27), alcohol dehydrogenase (AtADH; spot ID 40), and nitrilase 1 (AtNit1; spot ID 42). When purified AtMetS, AtADH, and AtNit1 were treated with GSSG alone, no thiolated adducts could be determined by ESI-MS in any case. This lack of in vitro thiolation was particularly surprising for AtMetS, as this protein was identified from the urea-washed sample and was therefore an excellent candidate for S-glutathionylation.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Electrospray-MS analysis of AtGSTZ1 before (solid line) and after (dashed line) treatment with oxidized glutathione, showing efficient single glutathionylation of enzyme (E) and its dehydrated form (E – H2O). Spectra are deconvoluted from multiply charged ion spectra. The expected mass for AtGSTZ1 (after cleavage of the initial Met) was 25,807.5 D.

 
Since the studies with the recombinant proteins relied on spontaneous disulfide exchange between the polypeptide and GSSG, one possibility was that the thiolation of these polypeptides observed in the crude protein extracts was due to the intervention of a catalyst. To test this possibility, the incubations with the recombinant proteins were repeated using GSSG-biotin in the presence or absence of crude Arabidopsis protein extract. Thiolation of the proteins was then monitored after resolving the repurified polypeptides by nonreducing SDS-PAGE and probing blots with streptavidin to detect GS-biotin-conjugated proteins (Fig. 6). In the presence of GSSG alone, this assay confirmed the spontaneous thiolation of AtDHAR1, with the respective GS-biotin-labeled monomer, dimer, trimer, and tetramer adducts identified in the absence of reducing agent (Fig. 6A). AtADH and AtMetS did not undergo thiolation in the presence of GSSG alone, though biotinylation of AtNit1 was detected even though this modification had not been determined previously by ESI-MS (Fig. 6E). Under nonreducing conditions, AtNit1 ran as a doublet of GSH-biotin-labeled protein. As determined with the other proteins, when AtNit1 was analyzed by SDS-PAGE under reducing conditions, an anti-His-tag serum only recognized a single polypeptide species in the preparation, suggesting that the multiple bands were due to AtNit1 species showing different degrees of thiolation. From this it was concluded that AtNit1 could undergo modest thiolation in the presence of GSSG alone, though this could only be detected with the very sensitive streptavidin-coupled blotting reagent. When the recombinant proteins were incubated with GSSG in the presence of the crude preparation from Arabidopsis, both AtADH and AtMetS formed GS-biotin-protein mixed disulfides (Fig. 6, B and G). In both cases, multiple polypeptide species were identified using streptavidin. In the case of AtMetS, the low molecular weight species were most likely due to proteolysis. Similarly, in the 2D gel electrophoresis experiments, several polypeptides with differing masses were identified by MALDI-TOF MS as AtMetS consistent with limited proteolysis of the parent protein. With AtADH, the single major polypeptide identified under nonreducing conditions appeared to correspond to the native enzyme. The other labeled protein species observed must have resulted from different charge/size variants of the unreduced polypeptide due to aberrant oxidation of sulfhydryl groups since the anti-His-tag serum only recognized a single species when AtADH was analyzed by SDS-PAGE under reducing conditions (Fig. 6D). Whereas AtMetS and AtADH only became thiolated in the presence of the Arabidopsis protein extract, the effect of adding the catalyst to the AtDHAR1 and AtNit1 preparations reduced their conjugation with GS-biotin (Fig. 6, A and E). Since the amount of target protein was unchanged (Fig. 6, B and F), we concluded that the reduction in thiolation was due to the competition for GSSG-biotin by the other proteins present in the crude extract. Having established that AtADH and AtMetS required other Arabidopsis proteins to become thiolated, it was of interest to determine how the associated reaction might be catalyzed. To test for the involvement of protein Cys mediating disulfide exchange reactions, the crude mixture was treated with iodoacetamide or p-chloromercuribenzoate (pCMB), two treatments known to differentially inhibit Cys-dependent enzymes. Protein-mediated thiolation of AtADH and AtMetS was lost on alkylation of sulfhydryl groups with iodoacetamide but was not inhibited by pCMB (Fig. 6, B and G).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 6. Western blots of recombinant proteins following exposure to GSSG-biotin. Recombinant proteins AtDHAR (blots A and B), AtADH (blots C and D), AtNit1 (blots E and F), and AtMetS (blots G and H) were exposed to GSSG-biotin under a variety of conditions. Gels A, C, E, and G were run under nonreducing conditions, whereas gels B, D, F, and H were run after reduction of the proteins. In each case, the polypeptide migrating as the expected monomeric species is arrowed, with any additional species being due either to intramolecular/intermolecular disulfide formation or to limited proteolysis. For each blot, lane 1 shows recombinant protein exposed to GSSG-biotin alone, lane 2 shows recombinant protein exposed to GSSG-biotin in the presence of crude Arabidopsis total protein extract, lane 3 shows recombinant protein exposed to GSSG-biotin in the presence of alkylated crude protein extract, lane 4 shows recombinant protein exposed to GSSG-biotin in the presence of crude protein extract and pCMB, and lane 5 shows recombinant protein exposed to crude protein extract in the absence of GSSG-biotin. Blots A, C, E, and G show GSSG-biotin-labeled proteins, whereas blots B, D, F, and H show His-tag detection of identical samples to the corresponding lanes in blots A, C, E, and G, showing equivalent recoveries of recombinant protein.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Using a combination of radiolabeling studies and in vivo and in vitro proteomics, we have demonstrated that protein thiolation is a widespread response to oxidizing conditions in Arabidopsis suspension cultures. By combining the results of the in vivo and in vitro GS-biotin-labeling studies, 2D-PAGE followed by MALDI MS identified 79 distinct proteins that can either be thiolated or form very stable complexes with glutathionylated proteins. It is also clear from the 2D gels that there are many other less abundant thiolated proteins to be identified. Surprisingly, the range of polypeptides found to undergo thiolation with GSSG-biotin was very different in the in vivo and in vitro labeling experiments. Two proteins, Suc synthase and a subunit of acetyl-CoA carboxylase, were identified as being thiolated in both studies, confirming that, where available, proteins would undergo mixed disulfide formation both in and outside the cellular environment. However, whereas in the in vitro studies a diverse range of polypeptides were thiolated, a much smaller range of proteins underwent this modification in vivo, and this was associated with their proteolytic degradation. There are many reasons to explain the differences in vivo and in vitro thiolation, including the bioavailability and compartmentalization of GS-biotin in the two test systems, and the redox status of the protein targets. For example, many of the proteins identified as undergoing thiolation in the sensitive in vitro screen may be constitutively S-glutathionylated in plant cells prior to feeding with GSSG-biotin and BHP. The proteolysis associated with the in vivo feeding study also indicated that the chemical treatments had seriously perturbed the cellular environment. For these reasons, the in vitro experiments give us a good appreciation of the total range of proteins that can undergo thiolation, as has recently been demonstrated with the Arabidopsis proteins undergoing S-nitrosylation (Lindermayr et al., 2005Go). The next technical challenge with these protein modification studies is to develop protocols allowing the reliable monitoring of these reactions within the cell while avoiding nonspecific side effects.

While there have been several recent large-scale proteomic studies directed at identifying redox reactive protein thiols in animal cells (Baty et al., 2002Go), bacteria (Leichert and Jakob, 2004Go), and plant cells (Lee et al., 2004Go), the experiments described in this study have identified proteins with redox-reactive Cys rather than residues that undergo selective reversible thiolation. Screens for thiolated proteins have been performed recently in yeast (Saccharomyces cerevisiae; Shenton and Grant, 2003Go) and human T-lymphocytes (Fratelli et al., 2002Go), extending earlier studies (Klatt and Lamas, 2000Go; Fratelli et al., 2004Go). However, our audit of thiolated proteins in Arabidopsis is particularly comprehensive, with the in vitro screen identifying a much greater diversity of proteins targeted for this modification than reported in a study with Arabidopsis cultures fed with biotinylated GSH in vivo (Ito et al., 2003Go).

Thiolation of protein sulfhydryl groups protects cysteinyl residues from irreversible oxidation to their sulfinic and sulfonic acid derivatives. As a freely reversible posttranslational modification, thiolation is known to regulate the activity of enzymes and regulatory proteins (Klatt and Lamas, 2000Go; Fratelli et al., 2004Go). Direct regulation by thiolation can be exerted on proteins containing catalytic Cys that are likely to be preferential targets for S-glutathionylation due to their inherent reactivity. Other less obvious effects of thiolation on protein function include prevention of substrate binding due to steric hindrance at or near the active site and changes in protein conformation at regulatory Cys modulating binding or catalysis. It is therefore clear that thiolation mediated by oxidative stress has the potential to regulate cellular events both directly and indirectly. For some proteins, thiolation has no apparent effect on their activity (Klatt and Lamas, 2000Go). However, even here protein thiolation may be of physiological importance in buffering the GSSG/GSH pool as well as having additional regulatory functions (Di Simplicio et al., 1998Go; Schafer and Buettner, 2001Go).

Based on the known roles for thiolation in animals, it is possible to functionally group the proteins identified by our proteomics approach in Arabidopsis into three sets: those whose activity is likely to be directly modulated by S-glutathionylation, those that undergo the modification without altering their immediate activity, and those proteins that have been identified because they are closely associated with thiolated proteins rather than undergoing this modification in their own right. To distinguish between glutathionylated proteins and any associated nonthiolated proteins, the streptavidin-bound proteins were washed with the denaturant 6 M urea to disrupt noncovalent interactions. Therefore, the urea wash should largely consist of polypeptides bound by protein-protein interactions rather than by thiolation. However, as denaturation exposed previously inaccessible Cys residues, there is a possibility that the revealing of the free thiols could promote intramolecular disulfide bond formation leading to the displacement of GS-biotin, thereby losing some thiolated proteins in this wash. Thus, while we can be confident that the proteins left on the streptavidin beads after urea treatment that were selectively eluted with DTT treatment were thiolated, it is also possible that some of the S-glutathionylated proteins were lost on denaturation.

We first considered those proteins that were thiolated due to their possession of reactive Cys in the active site. Enzymes that utilize active-site Cys as the respective reactive thiolate anions to drive catalysis are particularly susceptible to thiolation. The lambda GSTLs and DHARs had previously been characterized as glutathione S-transferases that could readily undergo thiolation in vitro (Dixon et al., 2002Go), as the S-glutathionylated adducts are putative reaction intermediates formed during catalysis. The fact that these enzymes were readily identified from crude extracts in the proteomics screen helped to confirm the efficacy of the purification method. The zeta-class AtGSTZ1 was also identified. AtGSTZ1 contains three Cys, with the active-site Cys-19 having been shown to be highly reactive and essential for catalysis (Thom et al., 2001Go). Our studies with the recombinant AtGSTZ-C19S mutant demonstrated that the active-site Cys was targeted for thiolation. Three of the identified proteins that belong to the nitrilase superfamily (nitrilases 1 and 3, and {beta}-ureidopropionase) contain catalytic Cys (Pace and Brenner, 2001Go), which would be susceptible to inactivation by thiolation. Similarly, cinnamoyl CoA reductase (Goffner et al., 1994Go; Lacombe et al., 1997Go) and inosine monophosphate dehydrogenase (Collart et al., 1996Go) have active-site Cys that would be preferentially thiolated.

The use of Cys to coordinate catalytic metal ions will also predispose proteins to thiolation. One of the most abundant proteins in the purified sample of thiolated proteins was AtMetS, as shown by its intense spot on 2D-PAGE and by the identification of numerous degradation products in the in vitro labeling study. The recent crystal structure of AtMetS (Ferrer et al., 2004Go) has identified Cys-649 and Cys-733 as residing in the active site and coordinating a zinc ion. These Cys are therefore likely candidates for thiolation, with this modification likely to inhibit enzyme activity as has been demonstrated with the enzyme in E. coli (Hondorp and Matthews, 2004Go). Our work has shown that AtMetS is catalytically thiolated by GSSG and is therefore likely to undergo thiolation-mediated inhibition of Met synthesis under conditions of oxidative stress.

Another group of proteins undergoing changes in function following thiolation do so by less well defined mechanisms. One major group of polypeptides identified in the thiolation screen contained components of the 20S proteasome. The 20S proteasome complex is made up of four seven-subunit rings (two {alpha}-subunit rings and two {beta}-subunit rings), each containing seven distinct polypeptides, giving a total of 14 different subunits, with several subunits in Arabidopsis being present as multiple genes (Parmentier et al., 1997Go). In the screen, 16 distinct polypeptide components of the 20S proteasome were identified, representing 13 of the 14 component subunits. Since these subunits associate to form the stable 20S proteasome structure, thiolation of any one subunit would result in the purification of the whole complex. At least seven of the 20S proteasome polypeptides were selectively retained on the streptavidin matrix after washing with urea, which strongly suggested that they had been directly thiolated, or that the 20S complex is exceptionally stable. Undefined subunits of the 20S proteasome in yeast (Demasi et al., 2003Go) and human liver cells (Demasi et al., 2001Go) undergo thiolation, with this modification inhibiting the chymotryptic activity of the complex while having no effect on trypsin-like activity. While the mechanism of this thiolation-mediated control is not known, our results would suggest that the link between redox change and the regulation of proteasome activity proposed in yeast and human also extends to plants.

There were then those proteins that were identified in the screen where thiolation probably did not directly affect activity. Because of our interest in glutathione-dependent enzymes, the presence of phi (GSTF)- and tau (GSTU)-class glutathione transferases was intriguing, as based on available structural models these proteins are unlikely to have Cys in their active sites (Prade et al., 1998Go; Thom et al., 2002Go). Since these were GSH-dependent enzymes, it was not possible to directly monitor the effect of thiolation on their activity, as the addition of the cosubstrate GSH immediately reduced any protein-bound mixed disulfides present. However, by indirect means we can infer that thiolation of GSTU and GSTF proteins is unlikely to affect enzyme activity directly. Thus, the related ZmGSTF1, ZmGSTU1, ZmGSTU2, and AtGSTF8 (as purified, recombinant proteins) could all be shown to be susceptible to thiolation. However, when alkylated with N-ethylmaleimide, GSH-conjugating activity was unaffected, suggesting that the reactive Cys could not be directly involved in catalysis (data not shown). Instead, it is possible that thiolation of Cys that are not at the active site might regulate protein turnover or protein-protein interactions.

Finally, there were examples of polypeptides that could not undergo thiolation and must have therefore been identified due to their close association with other S-glutathionylated proteins. One example was 20S proteasome {alpha}-subunit B1 (spot ID 3), which does not contain any cysteinyl residues. This polypeptide was recovered presumably due to its intimate association with other proteins in the proteasome complex that did undergo thiolation. Another example was the GSTF10 polypeptide (spot ID 22), which lacks any Cys. Since the GSTF10 subunit would have been bound to the streptavidin beads as a dimerized protein, it can be concluded that this polypeptide must have been associated with a related thiolatable subunit, such as GSTF7 (spot ID 21).

Major differences were determined in the proteins identified by the in vitro thiolation screen as compared with other searches for redox-reactive proteins in Arabidopsis. Only one previous study has reported protein thiolation in Arabidopsis. Using a carboxyethyl ester of biotinylated glutathione to aid uptake into intact living cells, thiolation of some 20 polypeptides resolved on a nonreducing SDS-PAGE gel was reported, with two identified as Fru-bisphosphate aldolase and triose phosphate isomerase (Ito et al., 2003Go). We also identified Fru-bisphosphate aldolase in our in vitro screen, while studies in yeast utilizing radiolabeled GSH identified both enzymes (Shenton and Grant, 2003Go). On comparing the 79 polypeptides identified within this study with the 65 Arabidopsis proteins identified by thiol affinity chromatography as containing disulfide bonds theoretically available for disulfide exchange (Lee et al., 2004Go), only three common hits were obtained. One major difference in the two studies was that, whereas the disulfide-proteome screen was carried out on Arabidopsis leaves, we employed dark-grown suspension cultures. Two of the proteins identified in both screens were aconitate hydratase-like protein (spot ID 51) containing 15 Cys and a 2-cys peroxiredoxin (spot ID 63; two Cys), with both predicted to be targeted to the plastid. In the case of the aconitate hydratase-like protein, it is probable that its identification by the two screens has been arrived at through different routes. Thus, three of the 15 Cys present are in the active site, allowing different residues to undergo either protein-protein or protein-GSH disulfide exchange reactions. However, 2-cys peroxiredoxin only contains two Cys that are proposed to form a protein-protein disulfide bond as part of the enzyme mechanism (Wood et al., 2003Go), hence the identification in the screen of Lee et al. (2004)Go. In our thiolation screen, the 2-cys peroxiredoxin has been identified either due to one of these Cys forming a protein-GSH disulfide or the protein being complexed with another thiolated protein. The third coidentified protein was cytosolic glyeraldehde-3-P dehydrogenase (spot ID G; two Cys).

Although relatively little attention has been paid to the regulatory roles of thiolation in plants, there has been very significant progress made in identifying those proteins targeted for thioredoxin-mediated disulfide exchange (Buchanan and Balmer, 2005Go). Comparison of these thioredoxin interacting proteins and our putatively glutathionylated proteins revealed 18 coidentified protein families, suggesting that many thiolated proteins are also substrates for thioredoxin.

From our analysis of the nature of the in vitro thiolation of five recombinant proteins by GSSG-biotin treatment, it is clear that Arabidopsis proteins can be thiolated by at least two mechanisms. AtDHAR1 and, to a lesser extent, AtNit1 underwent spontaneous thiolation in the presence of GSSG-biotin. By contrast, AtADH and AtMetS both required the inclusion of crude protein, with the associated thiolating activity inhibited by S-alkylation, providing good evidence for the requirement of an enzyme with a free sulfhydryl group to catalyze glutathionylation. The crude protein extract could promote thiolation by two mechanisms. First, the enzyme catalyst could increase the reactivity of the cysteinyl residue of the protein such that it can drive disulfide formation, for example, by converting the thiol to a reactive sulfenic acid derivative. Such a mechanism has been demonstrated for H2O2-mediated thiolation of 20S proteasome polypeptides in yeast (Demasi et al., 2003Go) and human serum albumin (Carballal et al., 2003Go). Enzymes mediating the thiolation of AtADH and AtMetS via sulfenic acid generation could therefore include superoxide dismutases producing H2O2 from reactive oxygen species present (Winterbourn et al., 2002Go), with three such enzymes present in Arabidopsis (Kliebenstein et al., 1998Go). Alternatively, thiolation using GSSG as thiol donor could be catalyzed by glutaredoxins (Lind et al., 1998Go). The regulation of thiolation/dethiolation in Arabidopsis and the functional significance of this reversible modification on the control of plant metabolism are currently under investigation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Chemicals

GSSG-biotin was synthesized by incubating 2.5 mM GSSG and 7.5 mM EZ-link sulfo-NHS-LC-LC-biotin (Perbio Science, Cramlington, UK) in 0.1 M potassium phosphate buffer, pH 8.0, for 2 h at 20°C. Unreacted biotin reagent was then removed by reacting with 20 mM Tris-Cl buffer, pH 7.5. The derivatization of both amino groups of GSSG was confirmed by ESI-MS with the expected reaction product (m/z for M + H+ = 1,517.6) determined. GSSG-biotin was stored at –20°C and was used without further purification.


Cell Cultures

Arabidopsis (Arabidopsis thaliana) cell cultures (50 mL) were maintained, used, and harvested in mid-log growth as described (Loutre et al., 2003Go). For oxidative stress treatments, cultures were exposed to 1 mM BHP with controls consisting of additions of equivalent volumes (0.5 mL) of sterile distilled water. Cells were harvested at intervals over a 4-h period by vacuum filtration, frozen in liquid nitrogen, and stored at –80°C until required. For in vivo labeling of the thiol pool with L-[35S]Cys (1 µCi mmol–1; MP Biomedicals, Irvine, CA), cultures were preincubated for 1 h with 100 µg mL–1 cycloheximide prior to the addition of 25 µCi L-[35S]Cys. After a further 4 h, cells were then treated with either BHP or water. For in vivo thiolation labeling, GSSG-biotin (1 µM) was added to cell cultures. After 1 h, BHP was added to 1 mM and cells were harvested after a further 30-min incubation.


Thiol Analysis

All thiol analyses were carried out in triplicate on cells treated with L-[35S]Cys, using internal standards of GSH to correct for losses during derivatization (Cummins et al., 1997Go). To quantify total and protein-bound GSH, cells (1 g) were homogenized in 100 mM Tris-Cl, pH 7.5 (3 mL), on ice, centrifuged (13,000g, 5 min), and the supernatant decanted. Total GSH was then determined after reduction with NaBH4 and derivatization of the thiols with monobromobimane as described previously (Cummins et al., 1997Go). The S-bimane derivatives were separated by HPLC and quantified for GSH content using fluorescence and for radioactivity by passing the eluate through an in-line radioisotope detector (Beckman model 171 radioisotope detector; Beckman Instruments, Fullerton, CA). To measure the protein-bound GSH, the proteins were precipitated from the cell extract (3 mL) by adding of 100% (w/v) trichloroacetic acid to a final concentration of 10% trichloroacetic acid (v/v). The protein pellet was collected by centrifugation (13,000g, 5 min), washed twice in 300 µL 5% (v/v) perchloric acid, and then incubated with 300 µL 1 mM 1,4-DTT for 15 min. After recentrifuging, a 100-µL portion of this extract was then derivatized and analyzed for GSH as described for the total thiol pool. The specific radioactivity of the GSH in the total thiol sample was calculated and used to quantify the protein-bound GSH from the 35S associated with the respective S-bimane derivative.


Purification of Thiolated Proteins

All purification steps were carried out at 4°C. For in vitro thiolation studies, Arabidopsis cells (10 g) were homogenized in 0.1 M Tris-Cl, pH 7.5, containing 1 mM EDTA, 2 mM DTT, and, after centrifugation (13,000g, 20 min), protein precipitated by addition of (NH4)2SO4 to 80% saturation. Following recentrifugation, the protein pellet was desalted in 20 mM Tris-Cl, pH 7.5 (18 mL), using a HiTrap desalting column (Amersham Biosciences, Chalfont St. Giles, UK). GSSG-biotin (10 µM) was added to and the sample incubated for 10 min, prior to precipitation of the proteins with 80% (NH4)2SO4. The pellet was then washed with buffer A (20 mM Tris-Cl, 0.5 M NaCl, 1 mM EDTA, pH 6.8) containing 80% (NH4)2SO4, to remove unreacted GSSG-biotin, prior to desalting the protein in buffer A (12 mL). For in vivo thiolation, protein was extracted in 0.1 M Tris-Cl, pH 7.5, containing 1 mM EDTA and then treated as above, except that the initial desalting, GSSG-biotin treatment, and subsequent precipitation steps were omitted. To purify thiolated proteins, 750 µL of streptavidin-agarose resin (Amersham Biosciences), prewashed with buffer A, was added to the extract and mixed gently for 10 min. The matrix was pelleted by centrifugation (700g, 2 min) and washed four times with 40 mL buffer A. The matrix was then resuspended in buffer A (4 mL) containing 10 mM DTT for 15 min at 20°C to release proteins that had formed mixed disulfides with biotinylated GSH. The filtered protein extract was precipitated with acetone (16 mL) at –20°C for 16 h and the pellet washed with 80% acetone. As a control, the above was repeated using nonbiotinylated GSSG to detect proteins that bound nonspecifically to the streptavidin matrix. For in vitro thiolation studies, experiments were also performed with the inclusion of an extra wash procedure to remove proteins that were interacting with the thiolated proteins bound to the streptavidin rather than being disulfide bonded to the biotinylated GSH. After binding the thiolated protein mixture, the matrix was treated with 2.5 mL of buffer B (20 mM Tris-Cl, 6 M urea, pH 6.8). Following a 15-min incubation at 20°C, the displaced protein solution was separated from the matrix by filtration, with the streptavidin-agarose resin then washed two times with 25 mL buffer A and the disulfide-bound protein recovered with buffer A containing DTT.


Identification of Thiolated Proteins

Affinity-purified thiolated proteins were analyzed by 2D-PAGE. Acetone-precipitated proteins were redissolved in 340 µL isoelectric focusing (IEF) buffer (7 M urea, 2 M thiourea, 4% [w/v] CHAPS, 40 mM DTT, 0.5% pH 3-10NL ampholytes, 0.002% [w/v] bromphenol blue) and subjected to IEF on 18-cm pH 3-10NL Immobiline DryStrips (Amersham Biosciences) using a Multiphor II flatbed electrophoresis system as recommended by the manufacturer. Following IEF, strips were washed first in second dimension buffer (50 mM Tris-Cl, pH 8.8, 6 M urea, 30% [v/v] glycerol, 2% [w/v] SDS, 0.002% [w/v] bromphenol blue) containing 1% (w/v) DTT (15 min, 20°C), then in second dimension buffer containing 2.5% (w/v) iodoacetamide (15 min, 20°C). Strips were run on ExcelGel 2D homogeneous 12.5% PAGE gels (Amersham Biosciences), then stained with SYPRO Ruby protein gel stain (Invitrogen, Paisley, UK) or with silver stain. Major spots were picked, trypsin digested, and analyzed on a Voyager DE-STR MALDI-TOF mass spectrometer (Applied Biosystems, Warrington, UK) as described (Chivasa et al., 2002Go). The resulting peptide mass ions were used to screen a nonredundant protein database using Mascot (http://www.matrixscience.com/).


Cloning and Expression of AtADH1, AtMetS, and Nitrilase

The coding sequences of thiolated proteins were PCR amplified from cDNA prepared from an Arabidopsis ethanol-treated root culture (Dixon et al., 2002Go) using the primer combinations gcgcgccatatgtctaccaccggacagattattc and gcgcgcctcgagagcacccatggtgatgatgc for AtADH (gene At1g77120, accession no. AY045612), gcgcgccatatggcttcacacattgttggatac and gcgcgcctcgagcttggcactggcgagctgg for AtMetS (gene At5g17920, accession no. U97200), and gcgcgccatatgtctagtactaaagatatgtc and gcgcgcgtcgactttgtttgagtcatcctcagc for AtNit1 (gene At3g44310, accession no. X63445). Following cloning into the NdeI and XhoI sites of the expression vector pET-24a (Merck Biosciences, Nottingham, UK), sequence fidelity was confirmed and the respective cDNA expressed in Escherichia coli strain Rosetta2(DE3) pLysS. Following growth to mid-log phase at 37°C, expression was induced by addition of 1 mM isopropylthio-{beta}-galactoside, and the growth temperature was then reduced to 20°C and the bacteria harvested by centrifugation after 12 h. Recombinant proteins were purified using Ni2+-charged iminodiacetic acid Sepharose as described (Dixon et al., 2000Go).


In Vitro Thiolation of Purified Recombinant Proteins

Direct modification of purified proteins by thiol reagents and subsequent electrospray-MS analysis was performed using a Micromass LCT mass spectrometer as described previously (Dixon et al., 2002Go). To analyze for thiolation of proteins catalyzed by the Arabidopsis protein extract, recombinant protein was precipitated with (NH4)2SO4 and then incubated in 20 mM Tris-Cl, pH 7.5, containing 10 mM DTT at 4°C for 30 min. The reduced protein was desalted into 20 mM Tris-Cl, pH 7.5, using a HiTrap column to remove DTT, and individual 10-ng aliquots were mixed with crude plant protein (1 mg/mL), prepared as described for the in vitro thiolation experiments. Incubations consisted of (1) crude protein and 10 µM GSSG-biotin; (2) crude protein, 20 µM pCMB, and 10 µM GSSG-biotin; (3) crude protein with no GSSG-biotin; (4) alkylated crude protein and 10 µM GSSG-biotin (with alkylated protein prepared by exposing to 20 mM iodoacetamide for 30 min on ice then desalting); and (5) 20 mM Tris-Cl, pH 7.5 (without crude protein), and 10 µM GSSG-biotin.

After incubating for 20 min at 4°C, Ni-NTA magnetic agarose beads (50 µL; Qiagen, Crawley, UK) were added to purify the His-tagged recombinant proteins, which were then analyzed by SDS-PAGE under nonreducing conditions (DTT omitted from loading buffer). Thiolation was detected by western blotting onto polyvinylidene difluoride membrane and probing for proteins containing biotinylated GSH using alkaline phosphatase-linked streptavidin (Sigma-Aldrich, St. Louis). Recombinant protein recovery was monitored by anti-His C-terminal antibody (Invitrogen) and horseradish-peroxidase-linked anti-mouse secondary antibody using ECL+ detection using a Typhoon 9400 imaging system (Amersham Biosciences).

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.

Received December 23, 2004; returned for revision March 23, 2005; accepted May 3, 2005.


    FOOTNOTES
 
1 This work was supported by the Biotechnology and Biological Sciences Research Council (grant no. 12/P13738). Back

2 These authors contributed equally to the paper. Back

3 Present address: Smith and Nephew Research Centre, York Science Park, Heslington, York YO1 5DF, UK. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.058917.

* Corresponding author; e-mail robert.edwards{at}durham.ac.uk; fax 0044–191–334–1201.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Balmer Y, Koller A, del Val G, Manieri W, Schürmann P, Buchanan BB (2003) Proteomics gives insight into the regulatory function of chloroplast thioredoxins. Proc Natl Acad Sci USA 100: 370–375[Abstract/Free Full Text]

Balmer Y, Vensel WH, Tanaka CK, Hurkman WJ, Gelhaye E, Rouhier N, Jacquot J-P, Manieri W, Schürmann P, Droux M, et al (2004) Thioredoxin links redox to the regulation of fundamental processes of plant mitochondria. Proc Natl Acad Sci USA 101: 2642–2647[Abstract/Free Full Text]

Baty JW, Hampton MB, Winterbourn CC (2002) Detection of oxidant sensitive thiol proteins by fluorescence labeling and two-dimensional electrophoresis. Proteomics 2: 1261–1266[CrossRef][Medline]

Buchanan BB, Balmer Y (2005) Redox regulation: a broadening horizon. Annu Rev Plant Biol 56: 187–220[CrossRef][Medline]

Carballal S, Radi R, Kirk MC, Barnes S, Freeman BA, Alvarez B (2003) Sulfenic acid formation in human serum albumin by hydrogen peroxide and peroxynitrite. Biochemistry 42: 9906–9914[CrossRef][Medline]

Chivasa S, Ndimba BK, Simon WJ, Robertson D, Yu XL, Knox JP, Bolwell P, Slabas AR (2002) Proteomic analysis of the Arabidopsis thaliana cell wall. Electrophoresis 23: 1754–1765[CrossRef][ISI][Medline]

Collart FR, Osipiuk J, Trent J, Olsen GJ, Huberman E (1996) Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana. Gene 174: 217–220[Medline]

Cummins I, Moss S, Cole DJ, Edwards R (1997) Glutathione transferases in herbicide-resistant and herbicide-susceptible black grass (Alopecurus myosuroides). Pestic Sci 51: 244–250[CrossRef]

Demasi M, Shringarpure R, Davies KJA (2001) Glutathiolation of the proteasome is enhanced by proteolytic inhibitors. Arch Biochem Biophys 389: 254–263[CrossRef][ISI][Medline]

Demasi M, Silva GM, Netto LES (2003) 20S proteasome from Saccharomyces cerevisiae is responsive to redox modifications and is S-glutathionylated. J Biol Chem 278: 679–685[Abstract/Free Full Text]

Di Simplicio P, Cacace MG, Lusini L, Giannerini F, Giustarini D, Rossi R (1998) Role of protein -SH groups in redox homeostasis—the erythrocyte as a model system. Arch Biochem Biophys 355: 145–152[CrossRef][ISI][Medline]

Dixon DP, Cole DJ, Edwards R (2000) Characterisation of a zeta class glutathione transferase from Arabidopsis thaliana with a putative role in tyrosine catabolism. Arch Biochem Biophys 384: 407–412[CrossRef][ISI][Medline]

Dixon DP, Davis BG, Edwards R (2002) Functional divergence in the glutathione transferase superfamily in plants: identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. J Biol Chem 277: 30859–30869[Abstract/Free Full Text]

Ferrer J-L, Ravanel S, Robert M, Dumas R (2004) Crystal structures of cobalamin-independent methionine synthase complexed with zinc, homocysteine, and methyltetrahydrofolate. J Biol Chem 279: 44235–44238[Abstract/Free Full Text]

Fratelli M, Demol H, Puype M, Casagrande S, Eberini I, Salmona M, Bonetto V, Mengozzi M, Duffieux F, Miclet E, et al (2002) Identification by redox proteomics of glutathionylated proteins in oxidatively stressed human T lymphocytes. Proc Natl Acad Sci USA 99: 3505–3510[Abstract/Free Full Text]

Fratelli M, Gianazza E, Ghezzi P (2004) Redox proteomics: identification and functional role of glutathionylated proteins. Expert Rev Proteomics 1: 365–376[Medline]

Goffner D, Campbell MM, Campargue C, Clastre M, Borderies G, Boudet A, Boudet AM (1994) Purification and characterization of cinnamoyl-coenzyme A:NADP oxidoreductase in Eucalyptus gunnii. Plant Physiol 106: 625–632[Abstract]

Hondorp ER, Matthews RG (2004) Oxidative stress inactivates cobalamin-independent methionine synthase (MetE) in Escherichia coli. PLoS Biol 2: 1738–1753

Ito H, Iwabuchi M, Ogawa K (2003) The sugar-metabolic enzymes aldolase and triose-phosphate isomerase are targets of glutathionylation in Arabidopsis thaliana: detection using biotinylated glutathione. Plant Cell Physiol 44: 655–660[Abstract/Free Full Text]

Klatt P, Lamas S (2000) Regulation of protein function by S-glutathiolation in response to oxidative and nitrosative stress. Eur J Biochem 267: 4928–4944[ISI][Medline]

Kliebenstein DJ, Monde R-A, Last RL (1998) Superoxide dismutase in Arabidopsis: an eclectic enzyme family with disparate regulation and protein localization. Plant Physiol 118: 637–650[Abstract/Free Full Text]

Lacombe E, Hawkins S, Van Doorsselaere J, Piquemal J, Goffner D, Poeydomenge O, Boudet A-M, Grima-Pettenati J (1997) Cinnamoyl CoA reductase, the first committed enzyme of the lignin branch biosynthetic pathway: cloning, expression and phylogenetic relationships. Plant J 11: 429–441[CrossRef][ISI][Medline]

Lee K, Lee J, Kim Y, Bae D, Kang KY, Yoon SC, Lim D (2004) Defining the plant disulfide proteome. Electrophoresis 25: 532–541[CrossRef][ISI][Medline]

Leichert LI, Jakob U (2004) Protein thiol modifications visualized in vivo. PLoS Biol 2: 1723–1737

Lind C, Gerdes R, Schuppe-Koistinen I, Cotgreave IA (1998) Studies on the mechanism of oxidative modification of human glyceraldehyde-3-phosphate dehydrogenase by glutathione: catalysis by glutaredoxin. Biochem Biophys Res Commun 247: 481–486[CrossRef][ISI][Medline]

Lindermayr C, Saalbach G, Durner J (2005) Proteomic identification of S-nitrosylated proteins in Arabidopsis. Plant Physiol 137: 921–930[Abstract/Free Full Text]

Loutre C, Dixon DP, Brazier M, Slater M, Cole DJ, Edwards R (2003) Isolation of a glucosyltransferase from Arabidopsis thaliana active in the metabolism of the persistent pollutant 3,4-dichloroaniline. Plant J 34: 485–493[CrossRef][Medline]

Marchand C, Le Maréchal P, Meyer Y, Miginiac-Maslow M, Issakidis-Bourget E, Decottignies P (2004) New targets of Arabidopsis thioredoxins revealed by proteomic analysis. Proteomics 4: 2696–2706[CrossRef][ISI][Medline]

May MJ, Leaver CJ (1993) Oxidative stimulation of glutathione synthesis in Arabidopsis thaliana suspension cultures. Plant Physiol 103: 621–627[Abstract]

Motohashi K, Kondoh A, Stumpp MT, Hisabori T (2001) Comprehensive survey of proteins targeted by chloroplast thioredoxin. Proc Natl Acad Sci USA 98: 11224–11229[Abstract/Free Full Text]

Pace HC, Brenner C (2001) The nitrilase superfamily: classification, structure and function. Genome Biol 2: REVIEWS0001

Parmentier Y, Bouchez D, Fleck J, Genschlik P (1997) The 20S proteasome gene family in Arabidopsis thaliana. FEBS Lett 416: 281–285[CrossRef][ISI][Medline]

Prade L, Huber R, Bieseler B (1998) Structures of herbicides in complex with their detoxifying enzyme glutathione S-transferase: explanations for the selectivity of the enzyme in plants. Structure 6: 1445–1452[Medline]

Schafer FQ, Buettner GR (2001) Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radic Biol Med 30: 1191–1212[CrossRef][ISI][Medline]

Shenton D, Grant CM (2003) Protein S-thiolation targets glycolysis and protein synthesis in response to oxidative stress in the yeast Saccharomyces cerevisiae. Biochem J 374: 513–519[CrossRef][ISI][Medline]

Thom R, Cummins I, Dixon DP, Edwards R, Cole DJ, Lapthorn AJ (2002) Structure of a tau class glutathione S-transferase from wheat active in herbicide detoxification. Biochemistry 41: 7008–7020[CrossRef][Medline]

Thom R, Dixon D, Edwards R, Cole D, Lapthorn A (2001) Structure determination of zeta class glutathione transferase from Arabidopsis thaliana. Chem Biol Interact 133: 53–54

Winterbourn CC, Peskin AV, Parsons-Mair HN (2002) Thiol oxidase activity of copper,zinc superoxide dismutase. J Biol Chem 277: 1906–1911[Abstract/Free Full Text]

Wood Z, Schröder E, Harris JR, Poole LB (2003) Structure, mechanism and regulation of peroxiredoxins. Trends Biochem Sci 28: 32–40[CrossRef][ISI][Medline]

Yamazaki D, Motohashi K, Kasama T, Hara Y, Hisabori T (2004) Target proteins of the cytosolic thioredoxins in Arabidopsis thaliana. Plant Cell Physiol 45: 18–27[Abstract/Free Full Text]


Related articles in Plant Physiol.:

On the Inside
Peter V. Minorsky
Plant Physiol. 2005 138: 1896-1897. [Full Text]  



This article has been cited by other articles:


Home page
Mol PlantHome page
X.-H. Gao, M. Bedhomme, D. Veyel, M. Zaffagnini, and S. D. Lemaire
Methods for Analysis of Protein Glutathionylation and their Application to Photosynthetic Organisms
Mol Plant, November 14, 2008; (2008) ssn072v1.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
B. Zechmann, F. Mauch, L. Sticher, and M. Muller
Subcellular immunocytochemical analysis detects the highest concentrations of glutathione in mitochondria and not in plastids
J. Exp. Bot., October 1, 2008; 59(14): 4017 - 4027.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S. Rinalducci, L. Murgiano, and L. Zolla
Redox proteomics: basic principles and future perspectives for the detection of protein oxidation in plants
J. Exp. Bot., October 1, 2008; 59(14): 3781 - 3801.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Michelet, M. Zaffagnini, H. Vanacker, P. Le Marechal, C. Marchand, M. Schroda, S. D. Lemaire, and P. Decottignies
In Vivo Targets of S-Thiolation in Chlamydomonas reinhardtii
J. Biol. Chem., August 1, 2008; 283(31): 21571 - 21578.
[Abstract] [Fu