Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Plant Physiology 134:1327-1331 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.
Agricola
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.
SCIENTIFIC CORRESPONDENCE

Abscisic Acid Induces Rapid Subnuclear Reorganization in Guard Cells1,[w]

Carl K.-Y. Ng2,*, Toshinori Kinoshita, Sona Pandey, Ken-ichiro Shimazaki and Sarah M. Assmann

Biology Department, Pennsylvania State University, University Park, Pennsylvania 16802 (C.K-Y.N., S.P., S.M.A.); and Department of Biology, Faculty of Science, Kyushu University, Ropponmatsu, Fukuoka 810–8560, Japan (T.K., K.S.)

While the phytohormone abscisic acid (ABA) is well established as a regulator of gene transcription and ion channel activity (Rock, 2000Go; Assmann and Wang 2001Go; Schroeder et al., 2001Go; Finkelstein et al., 2002Go), recent identification of RNA-binding proteins ABH1 (ABA hypersensitive), SAD1 (supersensitive to ABA and drought), and HYL1 (hyponastic leaves), whose mutation confers an ABA-hypersensitive phenotype (Lu and Fedoroff, 2000Go; Hugouvieux et al., 2001Go, 2002Go; Xiong et al., 2001Go), suggests that ABA may also play important roles in posttranscriptional RNA processing. Here we show that ABA dynamically regulates subnuclear architecture in guard cells, promoting the partitioning of a heterogeneous nuclear ribonucleoprotein (hnRNP)-type protein, AKIP1, into discrete subnuclear bodies or speckles via a process that has both Ca2+-dependent and Ca2+-independent steps and requires an active transcriptional machinery.

hnRNPs are mRNA-protein complex proteins (mRNP proteins) that bind RNA and affect its metabolism (Krecic and Swanson, 1999Go; Dreyfuss et al., 2002Go). Members of the hnRNP family are involved in all aspects of RNA metabolism, including pre-mRNA splicing, mRNA localization, mRNA stability, nuclear export of mRNA, and translational control (Dreyfuss et al., 1996Go, 2002Go; Krecic and Swanson, 1999Go; Mili et al., 2001Go; Reed and Magni, 2001Go). Binding of hnRNPs with nascent RNA transcripts results in the formation of ribonucleoprotein complexes (RNPs). RNPs are highly dynamic, and it has been demonstrated in mammalian cells that hnRNPs bind or dissociate from the target RNA at various stages of mRNA maturation until a distinct mRNP is formed and translocated from the nucleus to the cytoplasm for translation initiation (Dreyfuss et al., 2002Go). In plants, little is known about the function of hnRNPs (Albà and Pagès, 1998Go; Lorkovic et al., 2000Go; Lambermon et al., 2002Go; Lorkovic and Barta, 2002Go). We reported previously (Li et al., 2002Go) that AKIP1 is an hnRNP-like RNA binding protein from broad bean (Vicia faba). AKIP1 exhibits greatest sequence homology to mammalian hnRNP A/B and D proteins and has two RNA-recognition motifs. AKIP1 is phosphorylated by guard cell AAPK, an ABA-activated, Ca2+-independent protein kinase involved in ABA-regulation of stomatal closure and plasma membrane anion channel activity (Li and Assmann, 1996Go; Li et al., 2000Go). Upon phosphorylation, AKIP1 becomes competent to bind dehydrin mRNA, which encodes a class of stress-protectant proteins (Close, 1996Go, 1997Go). ABA treatment of guard cells expressing AKIP1-green fluorescent protein (GFP) also results in rapid subnuclear clustering of AKIP1-GFP. In this report, we examine the signal transduction machinery involved in this phenomenon.


    ABA PROMOTES REORGANIZATION OF AKIP1 INTO NUCLEAR SPECKLES
 TOP
 ABA PROMOTES REORGANIZATION OF...
 Ca2+-DEPENDENT AND Ca2+...
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We previously reported that AKIP1-GFP is localized to the nucleus in guard cells of broad bean (Li et al., 2002Go). This phenomenon was confirmed by immunolocalization experiments using anti-AKIP1 polyclonal antibody (see supplemental figure, which can be viewed at www.plantphysiol.org). This is interesting because studies using mammalian cells showed that hnRNP D proteins associate with pre-mRNA, are present both in the cytoplasm and nucleus, and are important in mRNA stability and turnover (Dreyfuss et al., 1996Go, 2002Go; Krecic and Swanson, 1999Go; Mili et al., 2001Go; Reed and Magni, 2001Go; Xu et al., 2001Go). Arabidopsis UBA2a, an hnRNP-like RNA binding protein, has also been reported to function in stabilization of transcripts (Lambermon et al., 2002Go). Our observations to date suggest that AKIP1, despite sequence homology to hnRNP D proteins, is unlikely to fulfill any cytoplasmic functions due to its nuclear localization. Thus, at present, the functional classification of AKIP1 within the various hnRNP subclasses requires further experimental analysis.

To further characterize the effect of ABA on rapid relocalization of AKIP1 within the guard cell nucleus, we investigated the time-course of ABA-induced relocalization of AKIP1-GFP into nuclear speckles. We observed that ABA-induced relocalization of AKIP1-GFP into nuclear speckles increased with time, over the 30 min observation period (Fig. 1, A and B ). The increase in number of speckles at 30 min is significantly greater in ABA-treated cells compared to control cells (Fig. 1C; P <= 0.05, ANOVA). This rapid response is further supported by time-lapse photography of AKIP1-GFP relocalization into nuclear speckles, which indicates that redistribution occurs as early as 10 min following treatment with 50 µM ABA (see supplemental video). Such rapidity in the response is in good agreement with our previous observations in guard cell protoplasts that ABA can induce, within 15 min, phosphorylation of AKIP1 and activation of dehydrin mRNA accumulation (Li et al., 2002Go).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Effect of ABA on subnuclear relocalization of AKIP1-GFP. A, Representative images of the effect of a 30 min incubation with buffer only (10 mM MES, 50 mM KCl, pH 6.2) on the distribution of AKIP1-GFP in the nucleus (n = 19). B, Representative images of the effect of a 30 min treatment with buffer containing 50 µM ABA on the distribution of AKIP1-GFP in the nucleus (n = 14). C, Kinetics of AKIP1-GFP relocalization in the nucleus over a period of 30 min in guard cells incubated in buffer only (n = 19) or buffer containing 50 µM ABA (n = 14). D, Kinetics of 50 µM ABA-induced AKIP1-GFP relocalization in the nucleus over a period of 30 min in guard cells pretreated for 30 min with buffer only (n = 15) or buffer containing a transcriptional inhibitor cocktail consisting of 10 µg/mL actinomycin D and 50 µg/mL {alpha}-amanitin (n = 16). E, Kinetics of 50 µM ABA-induced AKIP1-GFP relocalization in the nucleus over a period of 30 min in guard cells pretreated for 30 min with buffer only (n = 16) or buffer containing 2 mM 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (n = 17) or 2 mM EGTA (n = 7). Values are mean ± SE. F, ABA-dependent phosphorylation of AKIP1 in vivo. Top portion: AKIP1 was immunoprecipitated from 32P-labeled guard cell protoplasts using anti-AKIP1 polyclonal antibody. ABA was added at 50 µM with dimethyl sulphoxide (DMSO) as a vehicle. DMSO alone had no effect. Two millimolar EGTA or the transcriptional cocktail consisting of 10 µg/mL actinomycin D and 50 µg/mL {alpha}-amanitin did not significantly affect ABA-activation of AKIP1 phosphorylation in vivo. Bottom portion: Western blot showing that treatments did not alter the amount of AKIP1 protein available for phosphorylation. Data in both panels are representative of three separate experiments. G, Quantification of ABA-induced AKIP1 phosphorylation (as fold increase) in the absence or presence of 2 mM EGTA or a transcriptional cocktail consisting of 10 µg/mL actinomycin D and 50 µg/mL {alpha}-amanitin. Values are mean ± SE of three replicates. Bar = 10 µm.

 

    Ca2+-DEPENDENT AND Ca2+-INDEPENDENT SIGNALING STEPS COOPERATE TO MEDIATE ABA-INDUCED PARTITIONING OF AKIP1 INTO NUCLEAR SPECKLES
 TOP
 ABA PROMOTES REORGANIZATION OF...
 Ca2+-DEPENDENT AND Ca2+...
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We next used AKIP1-GFP to further dissect the signaling pathway(s) associated with ABA-induction of AKIP1 relocalization into nuclear speckles. Pretreatment of epidermal peels with a transcriptional inhibitor cocktail consisting of actinomycin D and {alpha}-amanitin (TI) dramatically attenuated ABA-induced relocalization of AKIP1 into nuclear speckles (Fig. 1D). This result suggests that transcriptional activation and the accumulation of target mRNAs are required for relocalization of AKIP1 into nuclear speckles. An alternative hypothesis would be that the presence of these pharmacological agents interfered with AAPK phosphorylation of AKIP1. However, this latter hypothesis is not supported; in vivo phosphorylation assays illustrate that the same transcriptional inhibitor cocktail did not affect ABA-induced phosphorylation of AKIP1 in guard cell protoplasts (Fig. 1, F and G). Interestingly, these data suggest that ABA-induced AKIP1 phosphorylation alone is insufficient for relocalization of AKIP1 into nuclear speckles and suggest that relocalization is dependent on both ABA-induced phosphorylation of AKIP1 and ABA-stimulation of gene transcription.

Several studies have indicated that ABA-activation of stress-related transcription is Ca2+-dependent (Sheen, 1996Go, 1998Go), and incubation of experimental material with buffers that chelate Ca2+ can reduce ABA-activation of gene expression (Wu et al., 1997Go; Webb et al., 2001Go). We decided to use a similar approach to examine the Ca2+ dependency of AKIP1 relocalization to nuclear speckles. We observed that pretreatment of epidermal peels with the Ca2+-chelators, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA), or EGTA inhibited ABA-induced relocalization of AKIP1 into nuclear speckles (Fig. 1E). This suggests that Ca2+-chelation is interfering either with AAPK phosphorylation of AKIP1 and/or ABA-activation of gene transcription. To examine these hypotheses, we assayed for ABA-activation of AKIP1 phosphorylation in vivo using guard cell protoplasts and showed that EGTA did not significantly affect ABA-induced phosphorylation of AKIP1 (Fig. 1, F and G). This result is consistent with our previous observation that AAPK catalytic activity in vitro is Ca2+-independent (Li and Assmann, 1996Go) and implicates Ca2+ participation in the speckling phenomenon at a step downstream or independent of AKIP1 phosphorylation.

To validate the use of the transcriptional inhibitors, and to evaluate the hypothesis that EGTA interference with ABA-induced gene expression might be responsible for its inhibitory effect on speckle formation, we analyzed the expression of the dehydrin gene in broad bean guard cells in response to ABA in the presence or absence of these pharmacological agents. Expression analysis by reverse transcription (RT)-PCR (Fig. 2A ) was quantitatively confirmed using real-time PCR(Q-PCR; Fig. 2B). Q-PCR data are presented as fold change in expression level over and above the control level.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Effect of EGTA and transcriptional inhibitors on dehydrin gene expression in broad bean guard cells. Highly purified broad bean guard cell protoplasts were treated with DMSO for 30 min (control), 50 µM ABA for 30 min (ABA), preincubation with 2 mM EGTA for 30 min followed by DMSO for 30 min (EGTA control) or 50 µM ABA for 30 min (EGTA plus ABA), and preincubation with transcriptional inhibitor mix for 2 h followed by DMSO for 30 min (TI control) or 50 µM ABA for 30 min (TI plus ABA). cDNA was synthesized from total RNA isolated from these guard cell protoplasts. A, RT-PCR with dehydrin primers shows amplification of a specific product that is up-regulated by ABA. PCR with ubiquitin primers is used as control. B, Identical cDNA samples were subjected to quantitative real time RT-PCR, using the SYBR Green dsDNA binding dye method. Change in expression level is presented as fold change in comparison to control cDNA. Amplification with ubiquitin primers served as an internal control. Data shown are means ± SD of three experiments. P < 0.03 (ANOVA).

 
The PCR results show the expected attenuation of the ABA-induced increase in dehydrin level by the transcriptional inhibitors (Fig. 2, A and B), validating their efficacy in inhibiting production of the AKIP1 target mRNA, dehydrin. ABA up-regulation of dehydrin transcript levels was also blocked by EGTA. This result suggests that the Ca2+ chelator is interfering with ABA-activation of gene transcription. Because the transcriptional inhibitors and EGTA inhibited both dehydrin gene expression and AKIP1 relocalization, these data suggest that transcriptional events, plausibly regulated by cytosolic Ca2+, are required for ABA-induced AKIP1 subnuclear partitioning.


    DISCUSSION
 TOP
 ABA PROMOTES REORGANIZATION OF...
 Ca2+-DEPENDENT AND Ca2+...
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Several functional categories of plant proteins have been shown to partition into nuclear speckles, suggesting the probable existence of different types of subnuclear bodies, as has been demonstrated for mammalian cells (Dreyfuss et al., 2002Go). Plant proteins known to exhibit a speckled localization include D polypeptide (a spliceosome protein; Glyn and Leitch, 1995Go) and atRSZ33, an Arg/Ser-rich RNA binding protein (Lopato et al., 2002Go), consistent with the speckled distribution of many mammalian splicing factors (Dreyfuss et al., 2002Go). The plant photoreceptors, phytochromes, and cryptochromes are also found in nuclear speckles (Yamaguchi et al., 1999Go; Más et al., 2000Go; Wang et al., 2001Go; Kircher et al., 2002Go; Yanovsky et al., 2002Go). Additionally, cryptochromes 1 and 2 as well as SPA1, a negative regulator of phytochrome A signaling, have been shown to colocalize with COP1, an E3 ubiquitin ligase (Osterlund et al., 2000Go; Wang et al., 2001Go; Seo et al., 2003Go). COP1 also colocalizes in speckles with AFP, which acts as a negative regulator of ABA signaling by promoting degradation of the colocalized ABI5 protein (Lopez-Molina et al., 2003Go). As such, the COP1-containing subset of nuclear speckles may function as sites for protein degradation (Osterlund et al., 2000Go; Lopez-Molina et al., 2003Go; Seo et al., 2003Go) analogous to clastosomes, which are nuclear bodies highly enriched in components of the ubiquitin-proteasome pathway, in mammalian cells (Lafarga et al., 2002Go). Future studies will be aimed at identifying other proteins residing in AKIP1-associated nuclear speckles, enabling determination of the exact category of subnuclear speckles in which AKIP1 resides, and elucidation of the role of AKIP1 protein in mRNA metabolism.

In conclusion, our data suggest that both Ca2+-independent and Ca2+-dependent processes cooperate to mediate relocalization of AKIP1 into nuclear speckles (Fig. 3 ). Our working model is that ABA acts via AAPK to modulate the phosphorylation status of AKIP1, priming it for subsequent binding of dehydrin and possibly other stress-related transcripts whose levels are up-regulated by ABA via cytosolic Ca2+ increases occurring during stress (Rock, 2000Go; Assmann and Wang, 2001Go; Evans et al., 2001Go; Webb et al., 2001Go). Our observations build on recent studies from the Fedoroff, Schroeder, and Zhu laboratories, suggesting that the double-stranded RNA binding protein HYL1, the RNA cap-binding protein ABH1, and the Sm-like snRNP SAD1 may have important functions in modulating ABA responses (Lu and Fedoroff, 2000Go; Hugouvieux et al., 2001Go, 2002Go; Xiong et al., 2001Go; Fedoroff, 2002Go; Kuhn and Schroeder, 2003Go). In particular, mutation of ABH1 has been shown to result in ABA-hypersensitivity of seed germination and stomatal closure and altered ABA-regulation of guard cell ion channels (Hugouvieux et al., 2001Go, 2002Go). It will be of interest to determine if ABA also induces the partitioning of HYL1, ABH1, and SAD1 into nuclear speckles in a manner similar to that observed for AKIP1, and whether ABA affects the subnuclear distribution of the ABA-related proteins AFP and ABI5 (Lopez-Molina et al., 2003Go). Finally, our results reveal that the rapidity of ABA signaling to the nucleus to alter nuclear architecture in stomatal guard cells is comparable to the rate of ABA-induced turgor responses in these cells. Thus, we propose that rapid subnuclear reorganization may form an important component of acclimatory stress responses in plants.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Working model for ABA-induced relocalization and retention of AKIP1 into nuclear speckles. ABA activates AAPK, leading to AKIP1 phosphorylation. At the same time, ABA activates transcription of dehydrin and/or other stress-related transcripts. Increased affinity of phosphorylated AKIP1 for dehydrin transcript facilitates relocalization into nuclear speckles.

 

    MATERIALS AND METHODS
 TOP
 ABA PROMOTES REORGANIZATION OF...
 Ca2+-DEPENDENT AND Ca2+...
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

AKIP1-GFP Subcellular Localization

Seeds of broad bean (Vicia faba) cv Long Pod were sorted according to size and smoothness of seed coat. Seeds measuring about 2.5 cm in length and 1.5 to 1.8 cm in width were selected. The initial selection of seeds according to size ensures uniformity in terms of germination and plant growth. Plants were grown in Metromix 360 (Scotts-Sierra, Marysville, OH) under a 10-h day/14-h night regime (photosynthetic photon flux density: 200 µmol m–2 s–1) at 22°C ± 2°C and watered every other day, alternating between one-half-strength Hoagland solution and water. Only the first fully-expanded leaves of 4- to 5-week-old plants were used for particle bombardment with AKIP1-GFP plasmids as described previously (Li et al., 2000Go, 2002Go). Expression was examined by fluorescence microscopy as described (Li et al., 2002Go). Fluorescence images of AKIP1-GFP distribution were acquired with a Sensys CCD camera (Photometrics, Trenton, NJ). The number of AKIP1-GFP labeled speckles was quantified from images taken at various times after incubation in 10 mM MES, 50 mM KCl, pH 6.2, with or without 50 µM ABA (A.G. Scientific, San Diego), 2 mM EGTA, or a transcriptional cocktail consisting of 10 µg/mL actinomycin D and 50 µg/mL {alpha}-amanitin. All chemicals were obtained from Sigma-Aldrich (St. Louis) unless otherwise stated.


In Vivo Phosphorylation Assay

Immunoprecipitation and in vivo phosphorylation assays were performed as previously described (Li et al., 2002Go).


RT-PCR and Real-Time Quantitative RT-PCR

Total RNA was isolated from guard cells of broad bean treated with Ca2+ chelators or transcriptional inhibitors using ISOGEN (Nippongene, Toyama, Japan). Five µg of total RNA was reverse transcribed using the Superscript II RT kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. cDNA was diluted at a concentration of 1:100, aliquoted, and kept at 4°C throughout each experiment to avoid discrepancies in the data due to freeze-thaw cycles. The PCR amplification was performed with oligonucleotides specific for dehydrin and ubiquitin cDNAs using the following primers:

Deh forward: AACAAGGTACGGTGGAAGTG
Deh reverse: ATCCTCCAGTACCAGGAAGC
Ub forward: GCAGCTCGAGGATGGAAGGA
Ub reverse: CCAGCTGCTTACCCGCAAAG.

The position of these oligonucleotides was chosen so that the size of the PCR products is between 200 and 250 bp. The suitability of the oligonucleotide sequences in terms of efficiency of annealing was evaluated using the Primer 3 program. The identity of both dehydrin and ubiquitin RT-PCR products was confirmed by sequencing.

Q-PCR experiments were repeated three times independently, and the data were averaged. For Q-PCR, the cDNA was amplified in the presence of SYBR-Green I dye (Molecular Probes, Eugene, OR) at 0.125x final concentration using a DNA Engine Opticon 2 thermal cycler (MJ Research, Waltham, MA). Amplification of ubiquitin cDNA under identical conditions was used as an internal control to normalize the level of cDNA. The data obtained were analyzed with Opticon 2 software (MJ Research). Since SYBR Green I dye binds to the minor groove of any dsDNA, including specific products, nonspecific products, and primer-dimers, it is necessary to perform a melting curve analysis at the end of each Q-PCR experiment. Nonspecific products or primer-dimers can be identified as they melt at a lower temperature compared to the specific amplicon. Specific melting temperatures obtained for ubiquitin (86°C) and dehydrin (84°C) validated the specific product formation.


    ACKNOWLEDGMENTS
 
The authors thank Drs. Z. Lorkovic and A. Barta (Vienna Biocenter) for discussion on AKIP1 sequence homology and structure. The authors declare that they have no competing financial interests.

Received October 13, 2003; returned for revision November 4, 2003; accepted December 24, 2003.


    FOOTNOTES
 
1 This work was supported by the National Science Foundation (grant no. MCB 00–86315 to S.M.A.) and by a grant from the Ministry of Education, Sports and Culture, Japan (to K.S. and T.K.). Back

2 Present address: Department of Botany, University College Dublin, Belfield, Dublin 4, Republic of Ireland. Back

[w] The online version of this article contains Web-only data. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.103.034728

* Corresponding author; e-mail carl.ng{at}ucd.ie; fax 353–1–7161153.


    LITERATURE CITED
 TOP
 ABA PROMOTES REORGANIZATION OF...
 Ca2+-DEPENDENT AND Ca2+...
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Albà MM, Pagès M (1998) Plant proteins containing the RNA-recognition motif. Trends Plant Sci 3: 15–21

Assmann SM, Wang X-Q (2001) From milliseconds to millions of years: guard cells and environmental responses. Curr Opin Plant Biol 4: 421–428[CrossRef][ISI][Medline]

Close TJ (1996) Dehydrins: emergence of a biochemical role of a family of plant dehydration proteins. Physiol Plant 97: 795–803[CrossRef]

Close TJ (1997) Dehydrins: a commonality in the response of plants to dehydration and low temperature. Physiol Plant 100: 291–296[CrossRef]

Dreyfuss G, Hentze M, Lamond AI (1996) From transcript to protein. Cell 85: 963–972[CrossRef][Medline]

Dreyfuss G, Kim VN, Kataoka N (2002) Messenger-RNA-binding proteins and the messages they carry. Nat Rev Mol Cell Bio 3: 195–205[CrossRef][ISI][Medline]

Evans NH, McAinsh MR, Hetherington AM (2001) Calcium oscillations in higher plants. Curr Opin Plant Biol 4: 415–450[CrossRef][ISI][Medline]

Fedoroff NV (2002) RNA-binding proteins in plants: the tip of an iceberg. Curr Opin Plant Biol 5: 452–459[CrossRef][ISI][Medline]

Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signalling in seeds and seedlings. Plant Cell Suppl 14: S15–S45

Glyn MCP, Leitch AR (1995) The distribution of a spliceosome protein in cereal (Triticeae) interphase nuclei from cells with different metabolic activities and through the cell cycle. Plant J 8: 531–540[CrossRef][Medline]

Hugouvieux V, Kwak JM, Schroeder JI (2001) An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis. Cell 106: 477–487[CrossRef][ISI][Medline]

Hugouvieux V, Murata Y, Young JJ, Kwak JM, Mackesy DZ, Schroeder JI (2002) Localization, ion channel regulation, and genetic interactions during abscisic acid signaling of the nuclear mRNA cap-binding protein, ABH1. Plant Physiol 130: 1276–1287[Abstract/Free Full Text]

Kircher S, Gil P, Kozma-Bognár L, Fejes E, Speth V, Husselstein-Muller T, Bauer D, Ádam É, Schäfer E, Nagy F (2002) Nucleocytoplasmic partitioning of the plant photoreceptors phytochrome A, B, C, D and E is regulated differentially by light and exhibits a diurnal rhythm. Plant Cell 14: 1541–1555[Abstract/Free Full Text]

Krecic AM, Swanson MS (1999) hnRNP complexes: composition, structure, and function. Curr Opin Cell Biol 11: 363–371[CrossRef][ISI][Medline]

Kuhn JM, Schroeder JI (2003) Impacts of altered RNA metabolism on abscisic acid signaling. Curr Opin Plant Biol 6: 463–469[CrossRef][ISI][Medline]

Lafarga M, Berciano MT, Pena E, Mayo I, Castaño JG, Bohmann D, Rodrigues JP, Tavanez JP, Carmo-Fonseca M (2002) Clastosome: a subtype of nuclear body enriched in 19S and 20S proteasomes, ubiquitin, and protein substrates of proteasome. Mol Biol Cell 13: 2771–2782[Abstract/Free Full Text]

Lambermon MHL, Fu Y, Wieczorek Kirk DA, Dupasquier M, Filipowicz W, Lorkovic ZJ (2002) UBA1 and UBA2, two proteins that interact with UBP1, a multifunctional effector of pre-mRNA maturation in plants. Mol Cell Biol 22: 4346–4357[Abstract/Free Full Text]

Li J, Assmann SM (1996) An ABA-activated and calcium-independent protein kinase from guard cells of fava bean. Plant Cell 8: 2359–2368[Abstract]

Li J, Kinoshita T, Pandey S, Ng CK-Y, Gygi SP, Shimazaki K, Assmann SM (2002) Modulation of an RNA-binding protein by abscisic-acid-activated protein kinase. Nature 418: 793–797[CrossRef][Medline]

Li J, Wang X-Q, Watson MB, Assmann SM (2000) Regulation of abscisic acid-induced stomatal closure and anion channels by guard cell AAPK kinase. Science 287: 300–303[Abstract/Free Full Text]

Lopato S, Forstner C, Kalyna M, Hilscher J, Langhammer U, Indrapichate K, Lorkovic ZJ, Barta A (2002) Network of interactions of a novel plant-specific Arg/Ser-rich protein, atRSZ33, with atSC35-like splicing factors. J Biol Chem 277: 39989–39998[Abstract/Free Full Text]

Lopez-Molina L, Mongrand S, Kinoshita N, Chua NH (2003) AFP is a novel negative regulator of ABA signaling that promotes ABI5 protein degradation. Genes Dev 17: 410–418[Abstract/Free Full Text]

Lorkovic ZJ, Barta A (2002) Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res 30: 623–635[Abstract/Free Full Text]

Lorkovic ZJ, Wieczorek Kirk DA, Lambermon MHL, Filipowicz W (2000) Pre-mRNA splicing in higher plants. Trends Plant Sci 5: 160–167[CrossRef][ISI][Medline]

Lu C, Fedoroff NV (2000) A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin and cytokinin. Plant Cell 12: 2351–2366[Abstract/Free Full Text]

Más P, Devlin PF, Panda S, Kay SA (2000) Functional interaction of phytochrome and cryptochrome 2. Nature 408: 207–211[CrossRef][Medline]

Mili S, Shu HJ, Zhao Y, Piñol-Roma S (2001) Distinct RNP complexes of shuttling hnRNP proteins with pre-mRNA and mRNA: candidate intermediates in formation and export of mRNA. Mol Cell Biol 21: 7307–7319[Abstract/Free Full Text]

Osterlund MT, Hardtke CS, Wei N, Deng XW (2000) Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature 405: 462–466[CrossRef][Medline]

Reed R, Magni K (2001) A new view of mRNA export: separating the wheat from the chaff. Nat Cell Biol 3: E201–E204[CrossRef][ISI][Medline]

Rock CD (2000) Pathways to abscisic acid-regulated gene expression. New Phytol 148: 357–396[CrossRef]

Schroeder JI, Kwak JM, Allen GJ (2001) Guard cell abscisic acid and engineering drought hardiness in plants. Nature 410: 327–330[CrossRef][Medline]

Seo HS, Yang J-Y, Ishikawa M, Bolle C, Ballesteros ML, Chua NH (2003) LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423: 995–999[CrossRef][Medline]

Sheen J (1996) Ca2+-dependent protein kinases and stress signal transduction in plants. Science 274: 1900–1902[Abstract/Free Full Text]

Sheen J (1998) Mutational analysis of protein phosphatase 2C involved in abscisic acid signal transduction in higher plants. Proc Natl Acad Sci USA 95: 975–980[Abstract/Free Full Text]

Wang H, Ma L-G, Li J-M, Zhao Y-H, Deng XW (2001) Direct interaction of Arabidopsis cryptochromes with COP1 in light control development. Science 294: 154–158[Abstract/Free Full Text]

Webb AAR, Larman MG, Montgomery LT, Taylor JE, Hetherington AM (2001) The role of calcium in ABA-induced gene expression and stomatal movements. Plant J 26: 351–362[CrossRef][ISI][Medline]

Wu Y, Kuzma J, Marechal E, Graeff R, Lee HC, Foster R, Chua NH (1997) Abscisic acid signaling through cyclic ADP-ribose in plants. Science 278: 2126–2130[Abstract/Free Full Text]

Xiong L, Gong Z, Rock CD, Subramanian S, Guo Y, Xu W, Galbraith D, Zhu JK (2001) Modulation of abscisic acid signal transduction and biosynthesis by an Sm-like protein in Arabidopsis. Dev Cell 1: 771–781[CrossRef][ISI][Medline]

Xu N, Chen CA, Shyu A (2001) Versatile role for hnRNP D isoforms in the differential regulation of cytoplasmic mRNA turnover. Mol Cell Biol 21: 6960–6971[Abstract/Free Full Text]

Yamaguchi R, Nakamura M, Mochizuki N, Kay SA, Nagatani A (1999) Light-dependent translocation of a phytochrome B-GFP fusion protein to the nucleus in transgenic Arabidopsis. J Cell Biol 145: 437–445[Abstract/Free Full Text]

Yanovsky MJ, Luppi JP, Kirchbauer D, Ogorodnikova OB, Sineshchevko VA, Ádam É, Kircher S, Staneloni RJ, Schäfer E, Nagy F, Casal JJ (2002) Missense mutation in the PAS2 domain of phytochrome A impairs subnuclear localization and a subset of responses. Plant Cell 14: 1591–1603[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
J. Qi, Q. Qian, Q. Bu, S. Li, Q. Chen, J. Sun, W. Liang, Y. Zhou, C. Chu, X. Li, et al.
Mutation of the Rice Narrow leaf1 Gene, Which Encodes a Novel Protein, Affects Vein Patterning and Polar Auxin Transport
Plant Physiology, August 1, 2008; 147(4): 1947 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Takahashi, T. Kinoshita, and K.-i. Shimazaki
Protein Phosphorylation and Binding of a 14-3-3 Protein in Vicia Guard Cells in Response to ABA
Plant Cell Physiol., August 1, 2007; 48(8): 1182 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
L.-z. Tao, A. Y. Cheung, C. Nibau, and H.-m. Wu
RAC GTPases in Tobacco and Arabidopsis Mediate Auxin-Induced Formation of Proteolytically Active Nuclear Protein Bodies That Contain AUX/IAA Proteins
PLANT CELL, August 1, 2005; 17(8): 2369 - 2383.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.
Agricola
Right arrow Articles by Ng, C. K.-Y.
Right arrow Articles by Assmann, S. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists