|
Plant Physiol, December 2002, Vol. 130, pp. 2039-2048
The Involvement of a Multicopper Oxidase in Iron Uptake by
the Green Algae Chlamydomonas
reinhardtii1
Alexandra
Herbik,
Christian
Bölling, and
Thomas J.
Buckhout*
Applied Botany, Humboldt University Berlin, Invalidenstrasse 42, 10115 Berlin, Germany
 |
ABSTRACT |
In the unicellular green algae Chlamydomonas
reinhardtii, high-affinity uptake of iron (Fe) requires an
Fe3+-chelate reductase and an Fe transporter. Neither of
these proteins nor their corresponding genes have been isolated. We
previously identified, by analysis of differentially expressed plasma
membrane proteins, an approximately 150-kD protein whose synthesis was induced under conditions of Fe-deficient growth. Based on homology of
internal peptide sequences to the multicopper oxidase hephaestin, this
protein was proposed to be a ferroxidase. A nucleotide sequence to the
full-length cDNA clone for this ferroxidase-like protein has been
obtained. Analysis of the primary amino acid sequence revealed a
putative transmembrane domain near the amino terminus of the protein
and signature sequences for two multicopper oxidase I motifs and one
multicopper oxidase II motif. The ferroxidase-like gene was transcribed
under conditions of Fe deficiency. Consistent with the role of a copper
(Cu)-containing protein in Fe homeostasis, growth of cells in
Cu-depleted media eliminated high-affinity Fe uptake, and Cu-deficient
cells that were grown in optimal Fe showed greatly reduced Fe
accumulation compared with control, Cu-sufficient cells. Reapplication
of Cu resulted in the recovery of Fe transport activity. Together,
these results were consistent with the participation of a ferroxidase
in high-affinity Fe uptake in C. reinhardtii.
 |
INTRODUCTION |
Copper (Cu) and iron (Fe) are
essential micronutrients and function as catalysts in a variety of
oxidation-reduction reactions. Because of their ability to generate
free radicals, uptake of Cu and Fe into cells and their assimilation
are tightly regulated to prevent both toxicity and deficiency.
Carrier-mediated transport systems for Fe and Cu have been identified
and characterized in several organisms. The high-affinity Fe uptake
system in yeast (Saccharomyces cerevisiae) is composed of
three enzymes, whose expression is regulated by the transcription
factor AFT1 and is inversely correlated with the cellular Fe content
(Yamaguchi-Iwai et al., 1995 , 1996 ). In
yeast, Fe is reduced by the Fe3+-chelate
reductases, FRE1 and FRE2, before transport by the high-affinity permease, FTR1 (Stearman et al., 1996 ; Georgatsou
et al., 1997 ). Also participating in uptake is the multicopper
oxidase, FET3 (Askwith et al., 1994 ). A structural and
functional interaction between the multicopper oxidase, FET3, and FTR1
has been shown (Stearman et al., 1996 ) and confirmed by
site-directed mutagenesis (Askwith and Kaplan,
1998 ).
Yeast cells also obtain Fe by means of a second low-affinity uptake
system (Dix et al., 1994 ). The low-affinity Fe uptake activity is catalyzed by the proteins FET4p (Dix et al.,
1994 ) and Smf1p and Smf2p (Liu et al., 1997 ). In
contrast to the high-affinity uptake system, these transporter systems
are composed of single proteins with broad metal specificity and
preferences for Fe2+ over
Fe3+. One further transport system in yeast with
homology to FET3 and FTR1 is found in the vacuole and encoded by FET5
and FTH1. This system is presumably involved in sequestration of Fe
either in detoxification or as a reservoir for metals to enable the
cell to grow under low Fe conditions (Stearman et al.,
1996 ; Spizzo et al., 1997 ;
Urbanowski and Piper, 1999 ).
The mechanism of Cu uptake in yeast has some similarity to the
mechanism for Fe uptake. As for Fe, Cu is reduced by a
Cu2+-chelate reductase before uptake
(Hassett and Kosman, 1995 ). Cu permeases are encoded by
CTR1 (Dancis et al., 1994a , 1994b ) and CTR3 (Knight et al., 1996 ), and the expression of
high-affinity Cu uptake genes is regulated by Cu availability and
mediated by the transcription factor MAC1 (Graden and Winge,
1997 ; Labbe et al., 1997 ; Yamaguchi-Iwai
et al., 1997 ). The Fe2+ permease, FET4,
also functions as a low-affinity Cu transporter and supports normal Cu
uptake in yeast (Hassett et al., 2000 ).
Fe uptake by human cells is somewhat more complex. Transferrin-mediated
Fe uptake and a further, not well-understood transferrin-independent uptake system have been described for uptake of Fe from the blood (Aisen et al., 2001 ). Intestinal Fe acquisition occurs
at the brush boarder of the duodenal epithelial cells with subsequent export of the Fe from the epithelial cells into the blood at the basal
border. Recently, McKie et al. (2001) identified
a mammalian plasma membrane b-type cytochrome with
Fe3+-chelate reductase activity in the duodenal
mucosa. A divalent cation transporter (DCT1p), also known as NRAMP2p
and DMT1p, is responsible for the uptake of Fe2+
from the intestinal lumen (Gruenheid et al., 1995 ;
Gunshin et al., 1997 ). Fe export from the duodenal
epithelial cells requires the Cu-dependent ferroxidase, hephaestin
(HEPH; Vulpe et al., 1999 ), and the permease MTP1p, which is induced
under Fe deficiency (Abboud and Haile, 2000 ).
In Arabidopsis, a reductase activity encoded by
FRO2 (Robinson et al., 1999 ) and an
Fe2+ transporter activity, encoded by
IRT1 and IRT2 (Eide et al., 1996 ;
Vert et al., 2001 ), have been shown to be involved in
the Fe transport. The expression of IRT2 was localized in
external cell layers of the root subapical zone; therefore, it was
suggested that this transporter was involved in the Fe uptake into the
roots (Vert et al., 2001 ). In addition, the existence of
six genes encoding NRAMP-like proteins was reported in Arabidopsis. It
was shown that AtNRAMP1 (Curie et al., 2000 )
and AtNRAMP3 and 4 (Thomine et al.,
2000 ) complemented the yeast fet3/fet4 mutant and that the
AtNRAMP1 accumulated in response to Fe deficiency, whereas AtNRAMP3 and 4 were induced by Fe starvation.
Further possible Fe transporters in Arabidopsis are encoded by eight
genes homologous to YS1 (yellow stripe), first described in
maize (Zea mays) and shown to catalyze the Fe uptake
from Fe3+ phytosiderophore complexes
(Curie et al., 2001 ).
Mechanisms analogous to higher plant strategy I and II have
been described in algae. Induction of a
Fe3+-chelate reductase and Fe uptake activity by
Fe deficiency has been best characterized in Chlamydomonas
reinhardtii (Eckhardt and Buckhout, 1998 ;
Lynnes et al., 1998 ; Weger, 1999 ),
although the enzymes catalyzing these reactions and their corresponding genes are unknown. Recently, a distinct increase of a 150-kD protein was observed by SDS-PAGE in the plasma membrane from Fe-deficient C. reinhardtii cells (Herbik et al., 2002 ).
After sequencing of internal peptides of this protein by
matrix-assisted laser desorption/ionization time of flight
(MALDI-TOF) mass spectrometry (MS), homology of two peptides to
expressed sequence tag (EST) clones was found (Herbik et
al., 2002 ). Based on physiological experiments and the homology
of internal peptides and deduced amino acid sequences to mammalian HEPH
and multicopper oxidases in general, it was suggested that this
ferroxidase-like protein (FLP) was a component of the Fe uptake complex.
In this study, we have begun a detailed examination of the function of
FLP in Fe uptake. Here, we report the full-length cDNA sequence for FLP
and the induction of FLP under conditions of Fe deficiency.
Furthermore, we have shown that Cu and a multicopper oxidase were
required for high-affinity Fe uptake. Thus, the mechanism of
high-affinity Fe uptake in C. reinhardtii resembled that
found in yeast and not that found in higher plants.
 |
RESULTS |
FLP Is a Multicopper Oxidase
Based on internal partial peptide sequences of
FLP (Herbik et al., 2002 ), two EST clones, AV395796 and
AV394010, were obtained and sequenced. Both clones were incomplete.
Therefore, 5'-RACE was employed to extend the existing clones and
identify a complete cDNA sequence (GenBank accession no.
AY074917). Sequence analysis of the cDNA
revealed an open reading frame (ORF) of 3,428 nucleotides with a
potential ATG start codon at position 250. The cDNA possessed a
3'-untranslated region of about 1,000 bp, which has been found in many
nuclear genes of C. reinhardtii (Franzén and
Falk, 1992 ; Dinant et al., 2001 ), and a
polyadenylation signal (TGTAA) located 13 bp upstream of the cDNA
poly(A+) sequence. An ORF encoding a protein of
1,142 amino acids with a calculated molecular mass of 131.8 kD and a pI
of 4.64 was deduced from the nucleotide sequence. From SDS-PAGE, the
molecular mass of the FLP protein was estimated to be 150 kD
(Herbik et al., 2002 ). The predicted sequence contained
possible glycosylation sites that may have accounted for the greater
molecular mass (PROSITE; Hofmann et al., 1999 ). Four
internal peptides sequenced in the previous study (Herbik et
al., 2002 ) were located in the deduced polypeptide, and peptide
maps obtained by MALDI-TOF MS analyses confirmed that the isolated gene
coded for FLP (Fig. 1; Herbik et al., 2002 ). Analysis of
the deduced amino acid sequence identified signature sequences for two
multicopper oxidase I motifs (767-787 and 1,117-1,137) and one
multicopper oxidase II motif (394-405; PROSITE; Hofmann et al.,
1999 ). Hydrophathy analyses predicted a potential transmembrane
domain for the FLP protein near to the amino terminus (amino acids
47-68; TMHMM; Moller et al., 2001 ).

View larger version (82K):
[in this window]
[in a new window]
|
Figure 1.
Comparison of the protein sequence of the FLP from
C. reinhardtii with mouse (Mus musculus) HEPH.
The alignment was performed using ClustalW from the EMBL database
(www.ebi.ac.uk/clustalw). Dark-gray shaded amino acids
represent identical residues and light gray indicates conserved
substitutions in the alignment. The FLP protein (GenBank accession no.
AY074917) and the HEPH protein (GenBank accession no. NP034547) show
31% sequence identity and 46% similarity. Additional features of FLP
are also shown. The multicopper oxidase motif I sequences are typed in
bold face and underlined, and the multicopper oxidase motif II is typed
in bold face. The amino acids 47 to 68 are the putative transmembrane
domain and are underlined with a dashed line, the six internal peptide
sequences from FLP obtained by MALDI-TOF MS are underlined, and
additional peptide maps are underlined twice.
|
|
The deduced amino acid sequence was compared with other
known multicopper oxidases that have been shown to be involved in Fe
transport. The predicted FLP amino acid sequence showed the greatest
sequence identity and similarity to mouse HEPH (accession no. NP03447)
over its entire length. The FLP and HEPH proteins were identical at
30% of their amino acid residues and displayed 45% similarity (Fig.
1). Homology of FLP was also detected to glycosylphosphatidylinositol-anchored ceruloplasmin (accession no. AAF34175, Rattus norvegicus, 29% identity, 43%
similarity) and yeast FET3p (accession no. CAA89768, 26% identity, 45% similarity). Interestingly, a potential transmembrane domain in
FLP was predicted near to the amino terminus and not at the carboxy
terminus, as was the case for HEPH (Fig. 1).
FLP Expression Was Induced in Response to Fe Deficiency
The FLP transcript was examined by probing total RNA with two
labeled DNA fragments derived from different regions of the FLP gene
(Fig. 2). The FLP-A probe was derived
from the 5' region (1-786) of the FLP gene, and the FLP-B probe was
located within the ORF at position 2,228 through 2,902. Compared with
the control, FLP was highly expressed after 1 d of Fe deficiency
as well as under combined Fe and Cu deficiency. The transcript length
of about 4.6 kb agreed with the predicted ORF obtained from the cDNA sequence. After 6 d of Cu deficiency, the expression of FLP was somewhat induced compared with the control. This induction in response
to Cu deficiency was distinctly less than after 1 d growth without
Fe. Thus, the transcription of the FLP gene was inversely correlated to
the supply of Fe and also Cu in the growth media.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
Expression analyses of the FLP gene in Fe- and
Cu-deficient C. reinhardtii cells. Northern-blot analysis
was performed with total RNA, and cells were grown under sufficient
conditions (+), 1 d in Fe-deficient medium ( Fe), 1 d under
combined Fe and Cu deficiency ( Fe/ Cu), and 6 d (+Fe/ Cu) in
Cu-depleted medium. Two different probes of the FLP gene (FLP-A was
derived from the 5'region and FLP-B was located at position
2,228-2,902) were used for hybridization. The 4.5-kb band corresponded
to the mature FLP mRNA. A control hybridization of an actin probe using
the same blots was also shown.
|
|
Repeating the northern analysis using the FLP-B probe, a similar
expression pattern was found; however, a signal at 2.5 kb in addition
to the 4.6-kb signal was prominent. These two different signals might
represent alternative splicing of a single gene, specific degradation
or they might represent products from two different genes. However,
Southern analyses using the FLP-A probe and FLP-B probe revealed a
simple pattern of hybridization (data not shown), suggesting the FLP
was unlikely to be coded by multiple genes.
Induction of the Fe3+- and Cu2+-Chelate
Reductase Activities Was Time Dependent
After 1 d of growth in Fe-deficient medium, both the
Fe3+- and Cu2+-chelate
reductases were induced to the maximum level (Fig.
3, A and B; see also Weger,
1999 ). However, an increase of both reductase activities was
observed after 2 to 3 d of growth on Cu-depleted TAP medium. A
maximum induction was reached between 6 and 8 d, although the
Fe3+- and the Cu2+-chelate
reductase activities were 10-fold lower in Cu-deficient as compared
with Fe-deficient cells (Fig. 3). Previous work showed no induction of
either reductase after 1 d of growth in Cu-deficient medium
(Eckhardt and Buckhout, 1998 ). From the results shown in Figure 3, it was evident that Cu deficiency increased
Cu2+- and Fe3+-chelate
reductase activities only after prolonged growth in Cu-deficient medium. Cu deficiency was confirmed by the decrease of the Cu content
in Cu-deficient cells (see below).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3.
Fe3+- and
Cu2+-chelate reductase activities of C. reinhardtii, grown in Fe- and Cu-sufficient and deficient media.
The cells were grown for 1 d without Fe and up to 6 d without
Cu. During the Cu-deficient growth, Tris-acetate-phosphate (TAP) medium
was renewed every 2nd d and the cells were diluted to an
OD750 of 0.2. Fe3+-chelate
(A) and Cu2+-chelate (B) reductase activities
were determined. Values represent the mean of three independent assays.
SEs are shown.
|
|
Fe Uptake Was Induced under Fe Deficiency and Inhibited under Cu
Deficiency
If FLP is a multicopper oxidase, like FET3p or HEPH, its ability
to oxidize Fe2+ will depend on Cu ions that
activate the enzyme (Stearman et al., 1996 ). After 1 d
of growth in Fe-deficient medium, both the Fe uptake (Fig.
4A) and Fe3+- and
Cu2+-chelate reductase activities (Fig. 4B) were
increased. Supplying Fe as Fe3+-HEDTA or as
Fe2+-HEDTA did not significantly affect the Fe
uptake activity (Fig. 4A). Importantly, cells starved of Cu and Fe
showed 85% inhibition of the Fe uptake activity compared with uptake
under Fe deficiency alone. After reapplication of 6 µM Cu
to cells starved of either Cu alone or both Fe and Cu, the Fe uptake
and the reductase activities could be restored to the control levels or
to the level found under Fe deficiency. These results clearly showed
that as in yeast and mammalian cells, a Cu-dependent step was involved
in the high-affinity Fe uptake in C. reinhardtii.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4.
The influence of Cu on Fe uptake (A) and Fe/Cu
reductase (B). C. reinhardtii cultures were subjected to
different treatments: 1, control; 2, 1 d without Fe; 3, 1 d
without Fe and 4 d without Cu; 4, 4 d without Cu; 5, 3 d
without Cu, supplemented with Cu for the last day; and 6, 3 d
without Cu and Cu resupply by concomitant remove of Fe for the last
day. A, Fe was applied as
Fe3+-hydroxyethylenediamine triacetic acid
(HEDTA), or for Fe2+ uptake 10 mM ascorbic acid was added (bars labeled with an
asterisk). B, Fe3+ and Cu2+ (*)
reductases were measured. Values represent the mean of three
independent assays. SEs are shown.
|
|
Inhibitory Effect of Tetrathiomolybdate (TTM) on Fe
Uptake
If a multicopper ferroxidase were involved in high-affinity Fe
transport, inhibition of this ferroxidase should abolish Fe transport.
To test this hypothesis, TTM, a well-known inhibitor of multicopper
oxidases, was employed (Chidambaram et al., 1984 ). Fe-deficient and -sufficient C. reinhardtii cells were
pre-incubated with TTM and Fe transport activity was determined
as described. The Fe uptake was slightly inhibited by the application
of 25 µM TTM to Fe-sufficient and -deficient
cells (Table I). A greater inhibition of
the Fe uptake was obtained by the addition of 250 µM TTM, with the Fe uptake being reduced by
74% in the Fe-sufficient cells and by 89% in the Fe-deficient cells.
These results were consistent with the involvement of a ferroxidase in
high-affinity Fe transport.
View this table:
[in this window]
[in a new window]
|
Table I.
Influence of the multicopper oxidase inhibitor TTM
on Fe uptake
Twenty-five and 250 µM TTM were added to a culture
containing 4.4 × 108 cells mL 1. TTM was
incubated for 0.5 and 4 h and the Fe uptake was measured (pmol
106 cells 1 h 1). These results
are averages of two independent assays. Percent inhibition is shown in
parentheses.
|
|
Micronutrient Content of Cells in Response to Fe and Cu
Deficiency
To confirm that the cell were deficient in Fe and Cu, Fe, Cu, Mn,
and Zn content were measured in combination with the reductase activities. When grown in full medium, the cells contained 560 µg Fe,
55 µg Cu, 50 µg Zn, and 290 µg Mn g dry
weight 1 (Fig. 5,
D-G). After 1 d of Fe deficiency, the Fe and Mn content decreased
by 70% and 71%, respectively. Surprisingly, Cu content increased by
39%, whereas Zn content remained unchanged. As shown, the
Fe3+- and the Cu2+-chelate
reductase activities increased under Fe deficiency (Fig. 5, B and C).
Removal of Cu for 2, 4, and 6 d led to a corresponding decrease in
Cu content and as for Fe deficiency, an increase in both Fe and Cu
reductase activities. In contrast to the uptake experiments where the
high-affinity Fe uptake was inhibited under Cu deficiency (Fig. 4A), Fe
as well as Zn increased with increasing Cu deficiency (Fig. 5, D and
F). We speculate that the accumulation of Fe and Zn under Cu deficiency
was likely the result of uptake by a low-affinity permease.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 5.
A through C, Total transition metal content of
C. reinhardtii cells grown in Fe- and Cu-depleted TAP
medium. A, Growth conditions up to 6 d: 1, control; 2, 1 d
without Fe; 3, 2 d without Cu; 4, 4 d without Cu; 5, 6 d
without Cu, 6, 3 d without Cu, supplemented with Cu for the last
day; 7, 3 d without Cu and Cu resupply by concomitant removal of
Fe for the last day; and 8, 4 d without Cu and reduction of the Fe
supply from 20 to 0.5 µM. Arrows shown in A
indicate the medium exchange and simultaneous cell dilution to an
A750 of 0.2. B, Fe3+
reductase. C, Cu2+ reductase activities. D, Fe
content; E, Cu content; F, Zn content; G, Mn content. These results are
averages of two independently grown cultures.
|
|
The changes induced by Cu deficiency were reversible. Resupply of Cu to
Cu-deficient cells led to a normalization of the content of all four
micronutrients to the level of the control. Furthermore, resupply of Cu to Cu- and Fe-deficient cells resulted in
micronutrient contents and reductase activities that were similar to
those described for Fe-depleted cells. Most importantly, supplying 0.5 µM Fe to Cu depleted cells resulted in maximally induced
reductase activity, reduced Fe and Cu content, and accumulation of Zn.
Thus, cells grown under Cu deficiency with optimal concentrations of Fe
did not accumulate Fe in contrast to Cu-deficient cells that were supplied with supra-optimal Fe, indicating the presence of a
low-affinity and a Cu-dependent, high-affinity Fe uptake system in
C. reinhardtii.
 |
DISCUSSION |
In this report, we present novel evidence linking FLP to
high-affinity Fe transport and propose that FLP is a ferroxidase, functioning in the reoxidation of Fe2+ before its
uptake into the cell. Initial evidence in support of this hypothesis
comes from the deduced FLP amino acid sequence. FLP contains two
multicopper oxidase I and one multicopper oxidase signature II motifs.
In addition, the amino acid sequence of FLP shows the highest homology
to multicopper oxidases in mammals (HEPH and ceruloplasmin) and yeast
(FET3). These proteins are ferroxidases that are themselves involved in
high-affinity Fe assimilation (Stearman et al., 1996 ;
Askwith and Kaplan, 1998 ; Mukhopadhyay et al.,
1998 ; Attieh et al., 1999 ; Vulpe et al., 1999 ). The involvement of FLP in Fe homeostasis is evident from the regulation of its synthesis. Both the transcription of the FLP gene
and synthesis of FLP are greatly increased in Fe-deficient cells and
reversed after resupply of Fe. Although we have not demonstrated the
ferroxidase activity in FLP directly, we have shown previously that
Fe-deficient C. reinhardtii cells have increased p-phenylenediamine oxidase activity compared
with Fe-sufficient controls (Herbik et al.,
2002 ). Furthermore, treatment of cells with TTM, an inhibitor
of multicopper oxidases, results in increased Fe3+ reductase activity (Herbik et al.,
2002 ) and an inhibition of high-affinity Fe uptake (Table I).
These data are at the least consistent with the function of FLP as a ferroxidase.
If FLP is a component of a high-affinity Fe uptake system, one would
expect it to be membrane bound. Consistent with this requirement, all
data collected thus far indicate a membrane localization of FLP. FLP
was initially identified in a membrane fraction highly enriched for the
plasma membrane (Herbik et al., 2002 ), and extraction of
this plasma membrane fraction with high salt and/or washing with
carbonate at pH 9 does not solubilize FLP (H.I. Reinhardt and T.J.
Buckhout, unpublished data). Structural analysis of the primary amino
acid sequence of FLP predicts an amino terminal transmembrane domain.
The presence of a single transmembrane domain is reminiscent of the
predicted structure of mammalian HEPH and yeast FET3; however, in these
proteins, the transmembrane domain is located on the carboxy terminus
of the protein. Structural analyses also predict that the major portion
of the protein is located on the outside surface of the cell (TMHMM;
Moller et al., 2001 ). Thus, with only one transmembrane
domain, FLP is unlikely to be a Fe permease. In analogy to HEPH and
FET3, we propose that FLP interacts with a presently unidentified Fe
transport protein to facilitate the movement of Fe across the membrane.
The proposed involvement of FLP in high-affinity Fe uptake in C. reinhardtii predicted a link between the Cu and Fe nutritional status of the cell and, thus, between Cu availability and Fe
acquisition. Results testing this hypothesis confirmed this link and
showed that Cu was necessary for high-affinity Fe transport. In
Fe-deficient C. reinhardtii, the Fe uptake activity
increased with decreasing Fe content (Fig. 4A). Removal of Cu from
Fe-deficient cells resulted in an inhibition of Fe uptake activity.
Furthermore, Fe uptake activity was also inhibited in Cu-deficient
cells (Fig. 4A), and, finally, depletion of cellular Cu was correlated
with decreased Fe in cells grown on medium containing sufficient but
not supra-optimal Fe and also with the absence of high-affinity Fe
transport. The reapplication of Cu to Cu-deficient cells restored the
Fe uptake activity to the level of the controls. In general, whenever
Cu was removed, the high-affinity Fe uptake activity was inhibited. In
yeast, Cu is also required for high-affinity Fe uptake (Askwith et al., 1994 ; Stearman et al., 1996 ). Mutations
either in the high-affinity Cu transporters (Dancis et al.,
1994b ; Yuan et al., 1995 ) or Cu deficiency
(Askwith et al., 1994 ) resulted in impaired Fe uptake.
Thus, in C. reinhardtii as in yeast, the involvement of a
Cu-containing step and a multicopper oxidase activity in the
high-affinity Fe uptake was apparent.
In addition to this high-affinity Fe uptake mechanism, there appeared
to be additional low-affinity and low-specificity transport activities
that were induced under Fe deficiency. The presence of such an activity
would explain the unexpected increase in Cu content in Fe-deficient
cells and the accumulation of Fe in Cu-deficient cells fed
supra-optimal concentrations of Fe (Fig. 5, D and E). Long-term
59Fe uptake experiments with Cu-depleted cells
confirmed the accumulation of Fe when Fe was supplied at high
concentrations (data not shown). The presence of low-affinity
transporters has been described in yeast. For example, FET4 was shown
to catalyze low-affinity Fe transport (Dix et al., 1994 ,
1997 ) and low-affinity Cu uptake (Hassett et al.,
2000 ). It was reported that yeast strains lacking high-affinity
Fe transport ( fet3) showed increased expression of FET4
and accumulated transition metals, which resulted in increased metal
sensitivity (Li and Kaplan, 1998 ). The distinct
accumulation of Fe and Zn demonstrated an accumulation of transition
metals by a Cu-independent system in C. reinhardtii. With
reduction of the Fe supply from 20 to 0.5 µM in
Cu-depleted cells, the high-affinity, Cu-dependent uptake activity and
the low-affinity uptake activity for Fe and Cu were distinguishable. As
expected under these conditions, Fe did not accumulate, and the Cu
content was reduced to a minimum. However, under these same conditions,
the Zn content increased by 200% (Fig. 5F). Although not characterized
in this study, these results were consistent with the presence of a
low-affinity Fe transport system.
Fe assimilation in C. reinhardtii involves an obligatory
reduction of cellular Fe3+-chelates, leading to
chelate splitting and subsequent Fe uptake. Both
Fe3+-chelate reductase and Fe uptake are induced
under Fe deficiency (Eckhardt and Buckhout, 1998 ;
Lynnes et al., 1998 ; Weger, 1999 ). What
function might a combined reduction of
Fe3+-chelates and reoxidation of
Fe2+ have in Fe uptake? Several authors have
proposed that the ferroxidase imparts specificity and selectivity to
high-affinity Fe uptake (Askwith et al., 1996 ;
Askwith and Kaplan, 1998 ; Eide, 1998 ) The reductases FRE1 and FRE2 in yeast (Dancis et al., 1992 ;
Hassett and Kosman, 1995 ) and FRO2 in Arabidopsis
are nonspecific and reduce a wide range of Fe3+-
as well as Cu2+-chelates (Robinson et al.,
1999 ). Divalent metal carriers from plants (Eide et al.,
1996 ; Korshunova et al., 1999 ; Curie et
al., 2000 , Rogers et al., 2000 ; Eckhardt
et al., 2001 ) as well as low-affinity transporters in yeast
(Dix et al., 1994 , 1997 ) are also
relatively unspecific. Thus, coupling Fe reduction to a ferroxidase
might impart greater substrate specificity to Fe transport. In
addition, uptake of Fe2+ into the cell would lead
to generation of toxic hydroxyl radicals via the Fenton reaction.
Reoxidation of Fe2+ concomitant with uptake of
Fe3+ into the cell would avoid the production of
oxygen radicals in the cell.
We have demonstrated for the first time, to our knowledge, a
Cu-dependent step in high-affinity Fe uptake in C. reinhardtii. Furthermore, we present evidence supporting the idea
that this Cu-dependent step involves the multicopper oxidase FLP as a
ferroxidase. Thus, the mechanism of Fe uptake in C. reinhardtii resembles that in yeast and not higher plants. Studies
are currently under way to test the model with loss-of-function mutants.
 |
MATERIALS AND METHODS |
Strains and Culture Conditions
The Chlamydomonas reinhardtii cell wall-deficient
mutant strain 83/81 (cw15 mt+) was grown in Fe-sufficient and
-deficient TAP medium, as described previously (Eckhardt and
Buckhout, 1998 ). Cell density was estimated at 750 nm
(Harris, 1988 ). Cultures were grown under Cu deficiency
essentially as described by Quinn and Merchant (1998) .
To induce Cu deficiency, cells were collected by centrifugation, washed
twice in Cu-free TAP medium, and resuspended in Cu-free TAP medium.
Cells were regularly diluted to an A750 of
0.1 to 0.2 every 2nd d and 1 d before the experiment began. All
glassware was rinsed overnight with 0.1 N HCl. Chemicals of the highest purity commercially available were used.
Fe3+- and Cu2+-Chelate Reductase Assays and
Fe Uptake Measurements
The Fe3+-chelate reductase was measured with 600 µM bathophenanthroline disulfonate as described by
Eckhardt and Buckhout (1998) . The
Cu2+-chelate reductase was measured with 100 µM bathocuproine disulfonate as described by Hill
et al. (1996) . In general, uptake experiments were
conducted as described by Eckhardt and Buckhout
(1998) with slight modifications to the uptake buffer
(20 mM MES, 20 mM Na-citrate, and 2 mM K-acetate, pH 6.2) and the quench solution (20 mM MES, 20 mM EDTA, and 2 mM
CaCl2, pH 6.2). Before each experiment, cells were washed
twice and then resuspended in uptake buffer. Five-hundred microliters
of this cell suspension (2.3-2.7 × 106 cells
mL 1) was combined with 100 µL of substrate solution.
When Fe3+ was used as a substrate, the uptake buffer
contained 12 µM FeCl3, 14.4 µM
HEDTA, and 1,000 cpm µL 1 59FeCl3 (Amersham,
Braunschweig, Germany). For Fe2+ uptake, 10 mM
ascorbic acid was added. The reaction was stopped after 1, 2, 4.5, 9, 13.5, and 18 min by addition of 10 mL of quench solution. Cells were
collected by filtration on glass fiber filters G/FC (Whatman, Kent, UK)
and were washed twice with 5 mL of quench solution. The radioactivity
was measured by liquid scintillation counting (Liquid Scintillation
Analyzer TRI-CARB 2900TR, Hewlett-Packard, Palo Alto, CA).
Micronutrient Analysis
The cells were digested with aqua regia in a microwave oven (2 mL of HNO3 and 6 mL of HCl; Mars 5-XP1500, CEM,
Kamp-Lintfort, Germany). To verify the sample preparation, the
certified reference material (BCR-CRM 414 Plankton, Institute for
Reference Materials and Measurements, Geel, Belgium) was digested by
the same method. The total concentrations of Fe, Mn, and Zn were
determined by inductively coupled plasma (ICP) atomic emission
spectrometry (Optima 3000, Perkin Elmer, Rodgau-Jügesheim,
Germany). A quadrupole mass spectrometer with ICP as excitation source
(ICP-MS Elan 5000; Perkin Elmer/Sciex, Rodgau-Jügesheim, Germany) was
used for Cu determination. Analyses of samples followed external
calibration with diluted single element and multielement standards.
Northern Blotting
Total RNA was isolated from C. reinhardtii cells
as described by Chomczynski and Sacchi (1987) . RNA was
separated by agarose gel electrophoresis, blotted onto Hybond
N+ (Amersham Biosciences, Freiburg, Germany), and
hybridized with the two FLP fragments that were randomly labeled with
[32P]dCTP (RediprimeII, Amersham Biosciences). For the
reverse transcription (Omniscript, Qiagen, Hilden, Germany), the
gene-specific primer GAGCCATGTTGACGGGGAAGTCC (FLP1) was used. For
amplification of the 786-bp fragment at the 5' end of the FLP gene
(FLP-A), the primers CCGGGCTATCGGGAACGCCCTTTGGCG (FLP2) and
CGCGAATGACCTGACCCACGGCG (FLP3) were used. For the amplification of
the second probe, an 874-kb fragment at position 2,028 through 2,902 (FLP-B), the primers ATGCTGTGGATGTACCACTCC (FLP4) and
CCCACCTCGGCAATGATCATGG (FLP5) were used. Blots were hybridized and the
last stringent washes were at 60°C with 0.1% (w/v) SSC + 0.1% (w/v) SDS for 15 min. The blot was then subjected to
autoradiography at 80°C.
5'-RACE and DNA Sequencing
To obtain the 5' end of the cDNA for the FLP gene, 5'-RACE was
performed according to the manufacture's instructions (Roche Molecular
Biochemical, Penzberg, Germany). After RNA isolation, contaminating DNA
was removed using DNA-free (Ambion, Austin, TX). For cDNA synthesis,
Omniscript reverse transcriptase (Qiagen) and AdvantageTM-GC2
polymerase (CLONTECH, Palo Alto, CA) were used to overcome problems
with the high GC content of C. reinhardtii sequences.
Primer CCAGTCCTGCGTTGTCGTGCTTC (FLP6) was used for first strand
synthesis at 42°C, primer GCCACAGGTAGGTGACTGTCTGC (FLP7) was used for
the first PCR, and primer GAGCCATGTTGACGGGGAAGTCC (FLP8) was used for
the nested PCR. For the cloning of the purified 1.0-kb fragment, a TA
cloning kit (Invitrogen, Karlsruhe, Germany) was used. DNA was
sequenced by automated ABI 373 sequencer (Applera, Weiterstadt,
Germany) using Big Dye Terminator Cycle Sequencing Chemistry.
Note Added in Proof
The C. reinhardtii sequence, FOX1, was
deposited in GenBank (accession no. AF450137) by Prof. Sabeebha
Merchant (Department of Chemistry and Biochemistry, University of
California, Los Angeles), and a report of this work has been recently
published (S. La Fontaine, J.M. Quinn, S.S. Nakamoto, M.D. Page, V. Göhre, J.L. Moseley, J. Kropat, S. Merchant [2002] Eykaryot Cell 1:
736-757).
 |
ACKNOWLEDGMENTS |
We thank Dr. René Frömmichen for micronutrient
analyses, Dr. Anke Koch for the support with the 5'-RACE, Dr. Martin
Meixner for DNA sequencing, and Jeane Heyd for excellent technical
assistance. The cDNA clone (EST no. AV304010) was generously provided
by the Kazusa DNA Research Institute (Kisarazu, Japan).
 |
FOOTNOTES |
Received August 14, 2002; accepted August 21, 2002.
1
This work was supported by the Deutsche
Forschungsgemeinschaft (grant to T.J.B.).
*
Corresponding author; e-mail h1131dqy{at}rz.hu-berlin.de, fax
49-30-20938725.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.013060.
 |
LITERATURE CITED |
-
Abboud S, Haile DJ
(2000)
A novel mammalian iron-regulated protein involved in intracellular iron metabolism.
J Biol Chem
275: 19906-19912[Abstract/Free Full Text]
-
Aisen P, Enns C, Wessling-Resnick M
(2001)
Chemistry and biology of eukaryotic iron metabolism.
Int J Biochem Cell Biol
33: 940-959[CrossRef][ISI][Medline]
-
Askwith C, de Silva D, Kaplan J
(1996)
Molecular biology of iron acquisition in Saccharomyces cerevisiae.
Mol Microbiol
20: 27-34[CrossRef][ISI][Medline]
-
Askwith C, Eide D, Van Ho A, Bernard PS, Li L, Davis-Kaplan S, Sipe DM, Kaplan J
(1994)
The FET3 gene of S. cerevisiae encodes a multicopper oxidase required for ferrous iron uptake.
Cell
76: 403-410[CrossRef][ISI][Medline]
-
Askwith C, Kaplan J
(1998)
Site-directed mutagenesis of the yeast multicopper oxidase Fet3p.
J Biol Chem
273: 22415-22419[Abstract/Free Full Text]
-
Attieh ZK, Mukhopadhyay CK, Sesadri V, Tripoulas NA, Fox PL
(1999)
Ceruloplasmin ferroxidase activity stimulates cellular iron uptake by a trivalent cation-specific transport mechanism.
J Biol Chem
274: 1116-1123[Abstract/Free Full Text]
-
Chidambaram MV, Barnes G, Frieden E
(1984)
Inhibition of ceruloplasmin and other copper oxidases by thiomolybdate.
J Inorg Biochem
22: 231-239[CrossRef][Medline]
-
Chomczynski P, Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162: 156-159[ISI][Medline]
-
Curie C, Alonso JM, Le Jean M, Ecker JR, Briat JF
(2000)
Involvement of NRAMP1 from Arabidopsis thaliana in iron transport.
Biochem J
347: 749-755
-
Curie C, Panaviene Z, Loulergue C, Dellaporta SL, Briat JF, Walker EL
(2001)
Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake.
Nature
409: 346-349[CrossRef][Medline]
-
Dancis A, Roman DG, Anderson GJ, Hinnebusch AG, Klausner RD
(1992)
Ferric reductase of Saccharomyces cerevisiae: molecular characterization, role in iron uptake, and transcriptional control by iron.
Proc Natl Acad Sci USA
89: 3869-3873[Abstract/Free Full Text]
-
Dancis A, Haile D, Yuan DS, Klausner RD
(1994b)
The Saccharomyces cerevisiae copper transport protein (CTR1p). Biochemical characterization, regulation by copper, and physiologic role in Cu uptake.
J Biol Chem
269: 25660-25667[Abstract/Free Full Text]
-
Dancis A, Yuan DS, Haile D, Askwith C, Eide D, Moehle C, Kaplan J, Klausner RD
(1994a)
Molecular characterization of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport.
Cell
76: 393-402[CrossRef][ISI][Medline]
-
Dinant M, Baurain D, Coosemans N, Joris B, Matagne RF
(2001)
Characterization of two genes encoding mitochondrial alternative oxidase in Chlamydomonas reinhardtii.
Curr Genet
39: 101-108[CrossRef][Medline]
-
Dix DR, Bridgham JT, Broderius MA, Byersdorfer CA, Eide DJ
(1994)
The FET4 gene encodes the low affinity Fe(II) transport protein of Saccharomyces cerevisiae.
J Biol Chem
269: 26092-26099[Abstract/Free Full Text]
-
Dix DR, Bridgham JT, Broderius MA, Eide DJ
(1997)
Characterization of FET4 protein of yeast. Evidence for a direct role in the transport of iron.
J Biol Chem
272: 11770-11777[Abstract/Free Full Text]
-
Eckhardt U, Buckhout TJ
(1998)
Iron assimilation in Chlamydomonas reinhardtii involves ferric reduction and is similar to strategy I higher plants.
J Exp Bot
49: 1219-1226[Abstract/Free Full Text]
-
Eckhardt U, Mas Marques A, Buckhout TJ
(2001)
Two iron-regulated cation transporters from tomato complement metal uptake-deficient yeast mutants.
Plant Mol Biol
45: 437-448[CrossRef][ISI][Medline]
-
Eide DJ
(1998)
The molecular biology of metal ion transport in Saccharomyces cerevisiae.
Annu Rev Nutr
18: 441-469[CrossRef][ISI][Medline]
-
Eide D, Broderius M, Fett J, Guerinot ML
(1996)
A novel iron-regulated metal transporter from plants identified by functional expression in yeast.
Proc Natl Acad Sci USA
93: 5624-5628[Abstract/Free Full Text]
-
Franzén LG, Falk G
(1992)
Nucleotide sequence of cDNA clones encoding the beta subunit of mitochondrial ATP synthase from the green alga Chlamydomonas reinhardtii: the precursor protein encoded by the cDNA contains both an N-terminal presequence and a C-terminal extension.
Plant Mol Biol
19: 771-780[CrossRef][ISI][Medline]
-
Georgatsou E, Mavrogiannis LA, Fragiadakis GS, Alexandraki D
(1997)
The yeast Fre1p/Fre2p cupric reductases facilitate copper uptake and are regulated by the copper-modulated Mac1p activator.
J Biol Chem
272: 13786-13792[Abstract/Free Full Text]
-
Graden JA, Winge DR
(1997)
Copper-mediated repression of the activation domain in the yeast Mac1p transcription factor.
Proc Natl Acad Sci USA
94: 5550-5555[Abstract/Free Full Text]
-
Gruenheid S, Cellier M, Vidal S, Gros P
(1995)
Identification and characterization of a second mouse Nramp gene.
Genomics
25: 514-525[CrossRef][ISI][Medline]
-
Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA
(1997)
Cloning and characterization of a mammalian proton-coupled metal-ion transporter.
Nature
388: 482-488[CrossRef][Medline]
-
Harris EH
(1988)
The Chlamydomonas Sourcebook: A Comprehensive Guide to Biology and Laboratory Use. Academic Press, San Diego
-
Hassett R, Dix DR, Eide DJ, Kosman DJ
(2000)
The Fe(II) permease Fet4p functions as a low affinity copper transporter and supports normal copper trafficking in Saccharomyces cerevisiae.
Biochem J
351: 477-484
-
Hassett R, Kosman DJ
(1995)
Evidence for Cu(II) reduction as a component of copper uptake by Saccharomyces cerevisiae.
J Biol Chem
270: 128-134[Abstract/Free Full Text]
-
Herbik A, Haebel S, Buckhout TJ
(2002)
Is a ferroxidase involved in the high-affinity iron uptake in Chlamydomonas reinhardtii.
Plant Soil
241: 1-9[CrossRef]
-
Hill KL, Hassett R, Kosman D, Merchant S
(1996)
Regulated copper uptake in Chlamydomonas reinhardtii in response to copper availability.
Plant Physiol
112: 697-704[Abstract]
-
Hofmann K, Bucher P, Falquet L, Bairoch A
(1999)
The PROSITE database, its status in 1999.
Nucleic Acids Res
27: 215-219[Abstract/Free Full Text]
-
Knight SAB, Labbé S, Kwon LF, Kosman DJ, Thiele DJ
(1996)
A widespread transposable element masks expression of a yeast copper transport gene.
Genes Dev
10: 1917-1929[Abstract/Free Full Text]
-
Korshunova YO, Eide D, Clark WG, Guerinot ML, Pakrasi HB
(1999)
The IRT1 protein from Arabidopsis thaliana is a metal transporter with a broad substrate range.
Plant Mol Biol
40: 37-44[CrossRef][ISI][Medline]
-
Labbe S, Zhu Z, Thiel DJ
(1997)
Copper-specific transcriptional repression of yeast genes encoding critical components in the copper transport pathway.
J Biol Chem
272: 15951-15958[Abstract/Free Full Text]
-
Li L, Kaplan J
(1998)
Defects in the yeast high affinity iron transport system result in increased metal sensitivity because of the increased expression of transporters with broad transition metal specificity.
J Biol Chem
273: 22181-22187[Abstract/Free Full Text]
-
Liu XF, Supek F, Nelson N, Culotta VC
(1997)
Negative control of heavy metal uptake by the Saccharomyces cerevisiae BSD2 gene.
J Biol Chem
272: 11763-11769[Abstract/Free Full Text]
-
Lynnes JA, Derzaph TLM, Weger HG
(1998)
Iron limitation results in induction of ferricyanide reductase and ferric chelate reductase activities in Chlamydomonas reinhardtii.
Planta
204: 360-365[CrossRef][ISI]
-
McKie AT, Barrow D, Latunde-Dada GO, Rolfs A, Sager G, Mudaly E, Mudaly M, Richardson C, Barlow D, Bomford A, et al
(2001)
An iron-regulated ferric reductase associated with the absorption of dietary iron.
Science
291: 1755-1759[Abstract/Free Full Text]
-
Moller S, Croning MD, Apweiler R
(2001)
Evaluation of methods for the prediction of membrane spanning regions.
Bioinformatics
17: 646-653[Abstract/Free Full Text]
-
Mukhopadhyay CK, Attieh ZK, Fox PL
(1998)
Role of ceruloplasmin in cellular iron uptake.
Science
279: 714-717[Abstract/Free Full Text]
-
Quinn J, Merchant S
(1998)
Copper-responsive gene expression during adaptation to copper deficiency.
Methods Enzymol
297: 263-279[ISI][Medline]
-
Robinson NJ, Procter CM, Connolly EL, Guerinot ML
(1999)
A ferric-chelate reductase for iron uptake from soils.
Nature
397: 694-697
-
Rogers EE, Eide DJ, Guerinot ML
(2000)
Altered selectivity in an Arabidopsis metal transporter.
Proc Natl Acad Sci USA
97: 12356-12360[Abstract/Free Full Text]
-
Spizzo T, Byersdorfer C, Duesterhoeft S, Eide D
(1997)
The yeast Fet5 gene encodes a Fet3-related multicopper oxidase implicated in iron transport.
Mol Gen Genet
256: 547-556[ISI][Medline]
-
Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, Dancis A
(1996)
A permease-oxidase complex involved in high-affinity iron uptake in yeast.
Science
271: 1552-1557[Abstract]
-
Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI
(2000)
Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes.
Proc Natl Acad Sci USA
97: 4991-4996[Abstract/Free Full Text]
-
Urbanowski JL, Piper RC
(1999)
The iron transporter Fth1p forms a complex with the Fet5 iron oxidase and resides on the vacuolar membrane.
J Biol Chem
274: 38061-38070[Abstract/Free Full Text]
-
Vert G, Briat JF, Curie C
(2001)
Arabidopsis IRT2 gene encodes a root-periphery iron transporter.
Plant J
26: 181-189[CrossRef][ISI][Medline]
-
Vulpe CD, Kuo YM, Murphy TL, Cowley L, Askwith C, Libina N, Gitschier J, Anderson GJ
(1999)
Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse.
Nat Genet
21: 195-199[CrossRef][ISI][Medline]
-
Weger HG
(1999)
Ferric and cupric reductase activities in the green alga Chlamydomonas reinhardtii: experiments using iron-limited chemostats.
Planta
207: 377-384[CrossRef]
-
Yamaguchi-Iwai Y, Dancis A, Klausner RD
(1995)
AFT1: a mediator of iron regulated transcriptional control in Saccharomyces cerevisiae.
EMBO J
14: 1231-1239[ISI][Medline]
-
Yamaguchi-Iwai Y, Serpe M, Haile D, Yang W, Kosman DJ, Klausner RD, Dancis A
(1997)
Homeostatic regulation of copper uptake in yeast via direct binding of MAC1 protein to upstream regulatory sequences of FRE1 and CTR1.
J Biol Chem
272: 17711-17718[Abstract/Free Full Text]
-
Yamaguchi-Iwai Y, Stearman R, Dancis A, Klausner RD
(1996)
Iron-regulated DNA binding by the AFT1 protein controls the iron regulon in yeast.
EMBO J
15: 3377-3384[ISI][Medline]
-
Yuan D, Stearman R, Dancis A, Dunn T, Beeler T, Klausner RD
(1995)
The Menkes/Wilson disease gene homologue in yeast provides copper to a ceruloplasmin-like oxidase required for iron uptake.
Proc Natl Acad Sci USA
92: 2632-2636[Abstract/Free Full Text]
© 2002 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
J. T. Ward, B. Lahner, E. Yakubova, D. E. Salt, and K. G. Raghothama
The Effect of Iron on the Primary Root Elongation of Arabidopsis during Phosphate Deficiency
Plant Physiology,
July 1, 2008;
147(3):
1181 - 1191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Chen, S. I. Hsieh, J. Kropat, and S. S. Merchant
A Ferroxidase Encoded by FOX1 Contributes to Iron Assimilation under Conditions of Poor Iron Nutrition in Chlamydomonas
Eukaryot. Cell,
March 1, 2008;
7(3):
541 - 545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Allen, J. A. del Campo, J. Kropat, and S. S. Merchant
FEA1, FEA2, and FRE1, Encoding Two Homologous Secreted Proteins and a Candidate Ferrireductase, Are Expressed Coordinately with FOX1 and FTR1 in Iron-Deficient Chlamydomonas reinhardtii
Eukaryot. Cell,
October 1, 2007;
6(10):
1841 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Fei and X. Deng
A Novel Fe Deficiency-Responsive Element (FeRE) Regulates the Expression of atx1 in Chlamydomonas reinharditii
Plant Cell Physiol.,
October 1, 2007;
48(10):
1496 - 1503.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Paz, E. Shimoni, M. Weiss, and U. Pick
Effects of Iron Deficiency on Iron Binding and Internalization into Acidic Vacuoles in Dunaliella salina
Plant Physiology,
July 1, 2007;
144(3):
1407 - 1415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Paz, A. Katz, and U. Pick
A Multicopper Ferroxidase Involved in Iron Binding to Transferrins in Dunaliella salina Plasma Membranes
J. Biol. Chem.,
March 23, 2007;
282(12):
8658 - 8666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bolling and O. Fiehn
Metabolite Profiling of Chlamydomonas reinhardtii under Nutrient Deprivation
Plant Physiology,
December 1, 2005;
139(4):
1995 - 2005.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hanikenne, U. Kramer, V. Demoulin, and D. Baurain
A Comparative Inventory of Metal Transporters in the Green Alga Chlamydomonas reinhardtii and the Red Alga Cyanidioschizon merolae
Plant Physiology,
February 1, 2005;
137(2):
428 - 446.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Eriksson, J. L. Moseley, S. Tottey, J. A. del Campo, J. Quinn, Y. Kim, and S. Merchant
Genetic Dissection of Nutritional Copper Signaling in Chlamydomonas Distinguishes Regulatory and Target Genes
Genetics,
October 1, 2004;
168(2):
795 - 807.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chen, Z. K. Attieh, T. Su, B. A. Syed, H. Gao, R. M. Alaeddine, T. C. Fox, J. Usta, C. E. Naylor, Robert. W. Evans, et al.
Hephaestin is a ferroxidase that maintains partial activity in sex-linked anemia mice
Blood,
May 15, 2004;
103(10):
3933 - 3939.
[Abstract]
[Full Text]
| |