|
Plant Physiol, February 2002, Vol. 128, pp. 418-427
AtREM1, a Member of a New Family of B3
Domain-Containing Genes, Is Preferentially Expressed in Reproductive
Meristems1
José M.
Franco-Zorrilla,
Pilar
Cubas,
José A.
Jarillo,
Begoña
Fernández-Calvín,
Julio
Salinas, and
José M.
Martínez-Zapater*
Departamento de Genética Molecular de Plantas, Centro
Nacional de Biotecnología, Campus de la Universidad
Autónoma de Madrid Cantoblanco, 28049 Madrid, Spain (J.M.F.-Z.,
P.C., J.A.J., J.M.M.-Z.); and Departamento de Mejora Genética y
Biotecnología, Instituto Nacional de Investigación y
Tecnología Agraria y Alimentaria, Carretera de La Coruña,
28040 Madrid, Spain (P.C., J.A.J., B.F.-C., J.S., J.M.M.-Z.)
 |
ABSTRACT |
We have isolated and characterized AtREM1, the
Arabidopsis ortholog of the cauliflower (Brassica
oleracea) BoREM1. AtREM1 belongs
to a large gene family of more than 20 members in Arabidopsis. The
deduced AtREM1 protein contains several repeats of a B3-related domain,
and it could represent a new class of regulatory proteins only found in
plants. Expression of AtREM1 is developmentally regulated, being first localized in a few central cells of vegetative apical meristems, and later expanding to the whole inflorescence meristem, as well as primordia and organs of third and fourth floral
whorls. This specific expression pattern suggests a role in the
organization of reproductive meristems, as well as during flower organ development.
 |
INTRODUCTION |
Plant morphogenesis depends upon the
mitotic activity of cells in the shoot apical meristem (SAM). During
the development of the plant, the SAM goes through different
developmental phases, characterized by the type and features of the
organs produced: leaves during the vegetative stage and flowers during
the reproductive phase (Poethig, 1990 ). Transition from vegetative to
reproductive development depends, in most annual plant species, on the
acquisition of competence by the SAM and the presence of specific
environmental conditions for temperature and photoperiod (for review,
see Bernier et al., 1993 ).
The use of experimental genetic systems like Arabidopsis and snapdragon
(Antirrhinum majus) has provided a tool to identify many of
the genes involved in the regulation of flowering time and flower
meristem and organ identity in those species. More than 80 genes whose
mutations alter the time to flower have currently been identified in
Arabidopsis, and many of them have been cloned and characterized at the
molecular level (for review, see Koornneef et al., 1998 ; Piñeiro
and Coupland, 1998 ; Simpson et al., 1999 ). In a similar way, mutations
that alter the identity of flower meristems in Arabidopsis have allowed
the identification of a set of genes required for the acquisition of
flower meristem identity such as LEAFY and
APETALA1 (Mandel et al., 1992 ; Weigel et al., 1992 ), as well
as other genes like APETALA2 (AP2),
CAULIFLOWER, and UNUSUAL FLORAL ORGANS, whose
mutations enhance the phenotype of lfy and ap1
mutants (Jofuku et al., 1994 ; Ingram et al., 1995 ; Kempin et al.,
1995 ).
In spite of the important role played by the genetic analysis in the
identification of key genes in different biological processes, the
results of current Arabidopsis genome sequencing projects show that
only 8% of the gene sequences identified have been experimentally characterized to date (Lin et al., 1999 ; Mayer et al., 1999 ). This is
likely the result of the absence of detectable phenotypic alterations
for mutations at many loci due to genetic or functional redundancy.
Molecular approaches designed to identify genes with particular
expression patterns have proved to be useful complementary approaches
for the identification of additional genes involved in specific
biological processes (Sablowski and Meyerowitz, 1998 ).
To identify new genes involved in reproductive development, we
constructed a cauliflower (Brassica oleracea) curd meristem cDNA library highly enriched in clones corresponding to transcripts specific to reproductive meristems (Franco-Zorrilla et al., 1999 ). Screening of this library allowed the characterization of one gene,
Brassica oleracea reproductive meristem gene 1 (BoREM1), whose expression was specific to cauliflower curd
meristems arrested in an early-inflorescence stage of development.
BoREM1 belongs to a gene family in cauliflower and encodes a
protein with features of transcriptional activators, but does not show
homology to any protein of known function (Franco-Zorrilla et al.,
1999 ). To understand the function of this new gene family in plants, we
have isolated the corresponding Arabidopsis gene. Here, we report the
molecular characterization of AtREM1, the ortholog of
BoREM1 in Arabidopsis. AtREM1 belongs to a large
gene family in Arabidopsis. Many REM family members are
present in clusters of tandemly repeated genes. The deduced proteins of
this family are characterized by the presence of a specific domain that
we have named the REM domain. This domain shares some sequence
similarity with the B3 domain found in the superfamily of B3-containing
transcriptional regulators such as VIVIPAROUS1/ABSCISIC ACID
INSENSITIVE 3 (VP1/ABI3; McCarty et al., 1991 ; Giraudat et al., 1992 ),
FUSCA3 (FUS3; Luerssen et al., 1998 ), AUXIN RESPONSE FACTORS (ARFs;
Ulmasov et al., 1997 , 1999 ), and RAV1 (Kagaya et al., 1999 ). In situ
hybridization analysis shows that AtREM1 expression is
restricted to a few cells in the vegetative SAM and expands to the
whole meristem in the inflorescence. AtREM1 is also
expressed in the central zone of floral meristems and becomes
progressively restricted to specific carpel cell types during the
development of the flower. Finally, plants carrying a T-DNA insertion
in AtREM1 coding sequence do not show any obvious mutant
phenotype, likely as a consequence of gene duplication.
 |
RESULTS |
AtREM1 Belongs to a New Arabidopsis Gene Family
One Arabidopsis gene similar to BoREM1 was initially
detected in DNA-blot hybridizations at moderate stringency conditions using different fragments corresponding to BoREM1 as probes
(data not shown). As BoREM1 is expressed in the meristematic
domes of the cauliflower curd (Franco-Zorrilla et al., 1999 ), we
screened a cDNA library prepared from young inflorescences of
Arabidopsis (Weigel et al., 1992 ) and we isolated a 1,775-bp cDNA. This
cDNA, named AtREM1, contained a long open reading frame
(ORF) starting at position 8, in agreement with the translation
initiation consensus sequence defined for plants (Lütcke et al.,
1987 ), and ending at position 1,561 (GenBank accession no. AF336344).
Sequence comparison between the AtREM1 cDNA clone and the
available genomic sequence of Arabidopsis revealed the existence of six
introns in the AtREM1 genomic sequence and allowed its
localization in bacterial artificial chromosome (BAC) clone F28
M20 (accession no. AL031004) from chromosome 4. Additional information on the 5'-untranslated region of
AtREM1 was obtained from a genomic clone, and the
transcription start site was mapped 51 bp upstream of the deduced
initiation codon by primer extension (data not shown).
The deduced AtREM1 protein consists of 517 amino acids with a
calculated molecular mass of 58.4 kD (Fig.
1A). It is rich in Lys, Asp, and Glu
residues, which confer to the protein a pI of 5.24. Sequence analysis
revealed the presence of two long (positions 160-282 and 283-418) and
one short (position 30-98) semiconserved characteristic repeats in the
AtREM1 deduced protein, referred to as the REM domains. Approximately
50% of the residues are similar within these repeats (Fig. 1B). AtREM1
also contains an acidic domain near the amino terminus, where 75% of
the residues are negatively charged, two stretches of basic residues,
resembling bipartite NLSs (Raikhel, 1992 ), as well as a putative
coiled-coil domain at the carboxy terminus formed by eight hydrophobic
repeats (Fig. 1A). The alignment between AtREM1 and BoREM1 from
cauliflower (Franco-Zorrilla et al., 1999 ) showed 61% identity and
73% similarity (Fig. 1A). Proteins of known functions similar to
AtREM1 could not be identified in the databases.

View larger version (83K):
[in this window]
[in a new window]
|
Figure 1.
The deduced AtREM1 protein. A, Alignment of the
deduced AtREM1 protein and its ortholog from cauliflower (accession no.
AF051772). Identical residues are in black, and conservative
substitutions are in gray. Characteristic domains of both proteins are
as follows: REM domains, including putative nuclear localization
signals (NLSs), are underlined. The acidic domain is enclosed by a box
and the putative coiled-coil domain is labeled with black dots under
hydrophobic residues. B, Amino acid alignment of the three REM domains
found in AtREM1.
|
|
As previously observed for BoREM1 in cauliflower
(Franco-Zorrilla et al., 1999 ), AtREM1 (REM1)
also belongs to a gene family in Arabidopsis. Genomic DNA sequences
from the Arabidopsis Genome Initiative have revealed the existence of
at least 23 sequences characterized by the presence of
duplicated REM domains (Table I; Fig.
2). Many of them also have acidic domains
and/or the heptad hydrophobic repeats at their C-terminal regions.
Fourteen of those sequences are organized as arrays of tandemly
repeated sequences. In fact, REM1 is part of a tandem array
of nine related genes in chromosome 4 (Fig. 2B), and there is one
additional cluster formed by five putative gene sequences in chromosome
2 (Fig. 2B). The rest of the related sequences were found in
independent chromosomal positions. REM1 showed highest similarity to
the corresponding BoREM1 from cauliflower, suggesting that
AtREM1 is the ortholog gene of BoREM1 (Fig. 2C).
Similarity searches in databases using the REM repeats as a query did
not reveal any similar protein in yeast or animal systems. However, a
consensus sequence within the REM domain showed similarity to conserved
residues within the B3 domain of the superfamily of B3-containing
transcriptional regulators, composed by VP1/ABI3, FUSCA3, ARFs, and
RAVs (Fig. 2D; McCarty et al., 1991 ; Giraudat et al., 1992 ; Ulmasov et
al., 1997 , 1999 ; Luerssen et al., 1998 ; Kagaya et al., 1999 ).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 2.
The REM gene family in Arabidopsis. A,
Schematic representation of the deduced REM proteins from predicted
genes found in databases. The REM domains are shown as black boxes.
Short stretches of acidic residues are represented as oval chains, and
putative NLSs are represented as triangles. Only seven of the deduced
proteins related to REM1 have heptad hydrophobic repeats at their C
terminus (vertical bars in an open box). B, Physical map of a 29-kb
genomic region including REM1 and related sequences in
tandem in chromosome 4 and another cluster of related genes in
chromosome 2. ORFs are represented by white boxes and introns are shown
with black bars. The direction of the deduced ORFs are indicated with
arrows. DUB-1 corresponds to a gene sequence with similarity
with a deubiquitinating enzyme. C, Unrooted phylogenetic tree showing
the relationships among the Arabidopsis REM proteins and BoREM1.
Branches with a support of 50 or more are indicated. D, Alignment of
consensus sequences from REM domain and B3 domains from ARFs and RAVs
proteins. A consensus at 60% for REM domain was obtained by alignment
of one deduced REM domain from each predicted gene. A consensus for B3
domain from ARFs was obtained from alignment of ARF1 to ARF10 as shown
in Ulmasov et al. (1999) , and that corresponding to RAV from alignment
of RAV1 and RAV2 as shown in Kagaya et al. (1999) . Identical residues
are in black, and conservative substitutions are in gray. Hydrophobic
residues (L, V, I, W, F, and Y) are represented as and aromatic
amino acids (W, F, and Y) are represented as . Hyphens are
introduced for optimization of the alignment.
|
|
As the characteristic REM domain resembles a DNA-binding domain and the
deduced REM1 protein contains two stretches of basic residues that
could act as NLSs, we studied the subcellular localization of the REM1
protein. For this purpose, we used a translational fusion between REM1
and the Escherichia coli -glucuronidase (GUS) in
transient expression assays (Varagona et al., 1991 ). REM1 targeted most
GUS activity into the nucleus of onion (Allium cepa)
epidermal cells (Fig. 3). This nuclear
localization of REM1 supports the functionality of the bipartite NLSs
and a nuclear function for REM1.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 3.
Subcellular localization of REM1 protein. A,
Histochemical GUS detection in a transient expression analysis on
epidermal onion cells of a REM1-GUS fusion protein. B,
4,6-Diamidino-2-phenylindole staining of the same group of
cells.
|
|
AtREM1 Is Preferentially Expressed in Inflorescence
Apices
The expression of REM1 was analyzed by RNA-blot
hybridization using poly(A)+ RNA from different
organs of adult plants. As shown in Figure 4A, a transcript of approximately 2 kb
was detected in inflorescence apices, being apparently absent in the
rest of the organs analyzed. A similar result was also obtained in
RT-PCR experiments (Fig. 4B), which showed that REM1 is also
expressed in immature and mature flowers, and in siliques at lower
level. To determine the time course of expression of REM1 in
the shoot apex, we performed RT-PCR experiments using total RNA
isolated from the apex at different times after germination. The
results showed that REM1 transcripts could already be
detected in apices excised from 6-d-old seedlings grown in petri dishes
under long-day photoperiods, and that their levels slightly increased
as development progressed (Fig. 4C).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 4.
Expression analysis of REM1. A, An RNA
blot containing 1.5 µg of poly(A)+ RNA from
different organs of Arabidopsis was hybridized with the cDNA
REM1 and a probe corresponding to ribosomal protein L3 as a
control for gel loading (RBP4; Kim et al., 1990 ). B,
Expression analysis of AtREM1 and AP2 by reverse
transcriptase (RT)-PCR in different organs from adult plants. RT-PCR
products were blotted onto membranes and hybridized with the
corresponding probes. C, RT-PCR analysis of expression of
REM1 in apices from young seedlings at different stages of
development. C, Cotyledon and hypocotyl from young seedlings; IA,
inflorescence apex; IF, immature flower, before anthesis; L, leaf; MF,
flower at anthesis; R, root; S, stem; Sq, silique.
|
|
To analyze the distribution of AtREM1 transcripts in the
plant apex, we performed in situ hybridization experiments on
Arabidopsis apices collected at different times during the development
of the plant. Plants were grown under short-day photoperiods to extend the period of vegetative development. Sections of plant tissue were
hybridized with REM1 digoxygenin-labeled riboprobes. Under those experimental conditions, REM1 mRNA was not detectable
in young seedlings (data not shown). Later, during vegetative
development, 12 to 17 d after sowing when the SAM was actively
producing leaf primordia, REM1 was detected at low levels in
the inner cell layers of the SAM (Fig.
5A). At flowering, the SAM shape changes
and starts producing flower meristems at its periphery. At this
time, REM1 was also detected in the SAM, but its expression
differed quantitatively and qualitatively from the vegetative
expression. The signal was higher and spread throughout the meristem
cell layers (Fig. 5, B and C). During reproductive development,
REM1 was expressed in the shoot apex and during flower
development. Although REM1 expression was absent at stage 1 of flower meristems, it appeared at stage 2 in the central area of the
flower meristem (Fig. 5C). In later stages 3 and 4, when sepal
primordia initiate and grow to enclose the bud, the AtREM1
hybridization signal became excluded from the developing sepals (Fig.
5, C and D). During stages 5 and 6, when petal and stamen primordia
first became visible, the hybridization signal was further restricted
to the central area of the floral meristem that gives rise to the
gynoecium and to small groups of cells at the tip and at the base of
stamens (Fig. 5, E and F). This latter group of cells could correspond to the presumptive nectaries (data not shown). After stage 6, REM1 expression was restricted to the developing gynoecium
being further restricted, during late stage 7, to the medial ridge of cells (Fig. 5, G and H). At stage 9, different regions of the gynoecium
became morphologically distinct from one another and REM1
mRNA was detected in the septum, style, and stigma (Fig. 5I). This
expression was maintained until the end of flower development (Fig.
5J). REM1 was also detected in lateral shoot meristems with a similar pattern to that shown in the primary SAM (data not shown). Thus, in agreement with the results of RNA-blot hybridizations and
RT-PCR experiments, REM1 was expressed in SAMs throughout development, although quantitative and qualitative differences were
observed between vegetative and reproductive expression patterns. Furthermore, REM1 was also expressed in floral
meristems from stage 2, with an expression pattern that became
progressively restricted to the gynoecium area that gives rise to the
style, stigma, and septum. Transgenic plants expressing the GUS
reporter gene (Jefferson et al., 1987 ) fused to the 5'-flanking region of REM1 (from 1,212 to +62, relative to the
transcriptional start site) reproducibly showed a GUS expression
pattern consistent with the results of RNA-blot hybridization, RT-PCR,
and in situ hybridization (data not shown).

View larger version (175K):
[in this window]
[in a new window]
|
Figure 5.
Expression patterns of REM1 during
Arabidopsis development. RNA in situ hybridization of Arabidopsis
(ecotype Col) probed with REM1. All sections are
longitudinal. A, 17-short-day rosette. The SAM, vm, produces leaves in
its periphery. REM1 signal is absent from L1 and is not
detected in leaf primordia. B, Inflorescence SAM, im, and young floral
meristems. Signal is detected in all three layers of the im. In stage 1 flower, REM1 mRNA is not detectable. In stage 2 flowers,
REM1 is expressed in the central area of the floral dome.
Arrows indicate the sepal anlagen. C, Stage 2 and 3 flowers showing
REM1 expression excluded from the sepal anlagen. D, Stage 3 and 4 flower. E, Stage 5 flower. Stamen primordia are now visible.
REM1 signal becomes restricted to the carpel anlagen. F,
Stage 6 flower. G, Stage 7 flower. H, Stage 7 and 8 flower,
REM1 mRNA accumulates in the medial ridge. I, Stage 9 flower. REM1 is expressed in the septum, style, and stigma.
J, Stage 12 flower shortly before anthesis. REM1 expression
is detected in the stigma and septum. Controls using REM1
sense probes gave no signal (not shown). vm, Vegetative SAM; im,
inflorescence SAM; l, leaf primordia; s, sepal; p, petal; st, stamen;
c, carpel. The numbers indicate stages according to Smyth et al.
(1990) .
|
|
AtREM1 Knockout Plants Do Not Show Conspicuous
Abnormalities
An Arabidopsis line carrying a T-DNA insertion in REM1
was identified by PCR screening of the T-DNA tagged lines obtained by
Feldmann (1991) . Segregation analysis for resistance to kanamycin revealed the presence of a unique T-DNA insertion in this line. Plants
homozygous for the insertion were identified by PCR genotyping, which
allowed the amplification of a single 1-kb PCR product with primers
corresponding to the left border of the T-DNA and the 3' end of
REM1 sequence, and failed to amplify the 2-kb fragment with
5' and 3' primers corresponding to the wild-type genomic sequence (Fig.
6). Sequence determination of the
LB/3'-PCR product indicated that the T-DNA was inserted in the coding
region of REM1 just before the Gln codon in position 299 and, therefore, it might be a null mutation. In fact, RNA-blot
hybridization and RT-PCR analysis with RNA obtained from inflorescence
apices of this mutant (rem1-1) failed to detect the
accumulation of REM1 transcripts, as well as other mRNA
species that could be derived from alternate splicing of the disrupted
REM1 gene (Fig. 6B). Mutant plants were grown and analyzed
under short- and long-day photoperiodic conditions and no phenotypic
differences were detected regarding flowering time or reproductive
development compared with sibling wild-type plants.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 6.
A, Isolation of a mutant line carrying a T-DNA
insertion in REM1. Map of the insertion of the T-DNA in the
coding sequence of REM1. Exons are represented with boxes
and characteristic domains of REM1 are as in Figure 1.
Between the left border of the T-DNA (LB) and REM1, a 16-bp
fragment of unknown derivation was found (underlined sequence). B,
REM1 expression in wild-type and in two rem1
homozygous lines. 1 and 2 denote different concentrations of cDNA
employed in PCR reactions (see "Materials and Methods"). PCR
corresponding to Trp synthase -subunit was used as a control.
|
|
 |
DISCUSSION |
The identification of AtREM1 demonstrates the validity
of using cauliflower meristems to isolate Arabidopsis genes
specifically expressed in its reproductive apex. Using a strategy based
on the search for specific expression patterns in pools of enhancer- or
gene-trap lines, Campisi et al. (1999) reported the isolation of
promoter trap lines exhibiting GUS staining patterns in the inflorescence. In fact, one of them carries one insertion between REM3 and REM4 showing specific inflorescence apex
expression (Campisi et al., 1999 ; T. Jack, personal communication).
Thus, both strategies may contribute to the identification of new genes
expressed in a small number of cells. Consistent with this,
REM genes are underrepresented in expressed sequence tag
(EST) databases. Only two ESTs from Arabidopsis corresponding to
REM-containing genes have been identified. One of them (GenBank
accession no. AV566479), isolated from a green siliques cDNA library,
corresponds to REM2, whereas the other one (accession no.
H76710) does not correspond to any gene listed in Table I. In addition,
a rice (Oryza sativa) EST (accession no. AU30260) from
immature leaves including apical meristems, as well as two tomato
(Lycopersicon esculentum) ESTs from fruits and carpels
(accession nos. AW441198 and AI489095, respectively) can be identified.
AtREM1 Contains Three Repetitions of a B3-Related DNA-Binding
Domain
The REM1 deduced protein has features characteristic of regulatory
proteins (Figs. 1 and 2). It contains a distinctive repetition of a
basic domain that we have named the REM domain. This domain is related
to the B3 domain of the VP1/ABI3-ARF family of transcriptional regulators (McCarty et al., 1991 ; Giraudat et al., 1992 ; Ulmasov et
al., 1997 ), which has been shown to bind DNA in vitro and in vivo
(Suzuki et al., 1997 ; Ulmasov et al., 1997 ). In addition to VP1/ABI3
and ARFs, RAV1 and RAV2 constitute another group of B3-containing
proteins (Okamuro et al., 1997 ; Kagaya et al., 1999 ). This group shows
an additional AP2-DNA-binding domain and it has been shown that AP2 and
B3 domains maintain autonomous DNA-binding activities to different DNA
motifs (Kagaya et al., 1999 ). Consensus sequences alignment in Figure
2D shows that the REM domain shares 28% to 30% similarity to both
types of B3 domains, which are more related between them (45%
similarity). Therefore, the REM domain is more distantly related to the
B3 domain found in ARFs and RAVs families of transcriptional
regulators. The presence of a putative DNA-binding domain, a functional
NLS, and the acidic domain, which has been proposed to function as an
activation domain (Mitchell and Tjian, 1989 ), suggests that REM1 can
function as a transcriptional regulator. In addition, the presence of a
putative coiled-coil domain in its carboxy terminus suggests that it
could specifically interact with other proteins (O'Shea et al.,
1989 ).
AtREM1 Expression Pattern Suggests a Role in
Reproductive Development
Different B3-containing proteins have been involved in different
aspects of plant development from seed maturation (ABI3) and embryo
development (MON/ARF5) to reproductive development (ETT/ARF3) (Giraudat
et al., 1992 ; Sessions et al., 1997 ; Hardtke and Berleth, 1998 ).
REM1 has a very specific pattern of transcript accumulation
in the SAM, starting in a few cells in the L3 layer of the vegetative
SAM and expanding to the three meristematic layers in the
inflorescence meristem (Fig. 4, A and B). Some genes are involved in
flower transition, such as AGL20 in Arabidopsis, SaMADS A, the putative ortholog of AGL20 in white
mustard (Sinapis alba), and
AGL8/FRUITFUL are also expressed in the SAM
(Mandel and Yanofsky, 1995 ; Menzel et al., 1996 ; Gu et al., 1998 ; Lee et al., 2000 ). Furthermore, the expression pattern of REM1
during flower development from stage 2 until stage 7 is coincident to that observed for AGL8/FUL (Fig. 4). Expression
of REM1 and AGL8/FUL differs from that
stage on, when both genes become expressed in complementary regions.
Another B3-containing gene, ETT/ARF3, is also
expressed in inflorescence meristems and in developing flowers, although flower expression pattern does not coincide with that of
REM1 (Sessions et al., 1997 ). Thus, the pattern of
expression of REM1 in the SAM, flower meristems, and in
carpels suggests a role for this gene in different aspects of
reproductive development. The lack of an obvious phenotypic alteration
in the T-DNA insertion mutant of REM1, likely due to genetic
redundancy, precludes having a clue of the role of this gene in plant
development. In this way, at least one homologous gene in the
REM1 cluster, REM3, could also have a redundant
function because its promoter-driven GUS expression suggests that it is
expressed with a similar pattern (T. Jack, personal communication).
The REM Gene Family
REM1 belongs to a large gene family characterized by
the presence of one to six REM repeats. Most of them also show
predicted acidic regions and potential NLSs, but the predicted
coiled-coil region is a feature characteristic of REM1 and other
deduced proteins in the cluster on chromosome 4 (Fig. 2A). Thus, the
presence of the B3-related domain or REM domain identifies a new gene
family formed by more than 20 putative genes in Arabidopsis. As with other groups within the B3 superfamily of transcription factors, the
REM family is present only in plants; no related proteins have been
found in any bacterial, fungal, or animal sequence present in databases.
Successive genome duplication events have likely generated the repeated
intragenic structure, as well as the tandem duplicated arrays of REM
genes found in different chromosomes. The low sequence similarity
observed between REM sequences in the cluster of chromosome 2 and those in the cluster on chromosome 4 indicates that they do not
derive from a recent duplication event. In fact, BAC F28 M20 containing REM1 is part of a
664-kb region in chromosome 4 that is duplicated in chromosome 2 (Blanc
et al., 2000 ). In general, REM genes are more related within
each cluster than between clusters. In this way, most of the deduced
proteins encoded by gene sequences in the chromosome 4 cluster contain
heptad hydrophobic repeats at their C terminus (Fig. 2A) that are
absent in other REM family members. Thus, REM genes in the
cluster on chromosome 4, with the exception of REM7, could
constitute a subgroup within the REM family. It is likely
that duplications and divergence within clusters were originated after
the chromosome duplication.
Among all the REM sequences found in Arabidopsis,
AtREM1 is the most related at nucleotide and amino acid
sequence level to BoREM1 from cauliflower (Figs. 1A and 2C).
Furthermore, AtREM1 is more related to BoREM1
than to any other REM-like sequence in the Arabidopsis
genome. This would indicate that the chromosomal duplication that gave
rise to segments of chromosomes 2 and 4, as well as former events of
gene duplication within the AtREM1 cluster, predate the
divergence of the Brassica and Arabidopsis genus. This
conclusion is consistent with previous observations of extensive
duplication and colinearity between Brassica and Arabidopsis
genomes (Schmidt, 2000 ).
In conclusion, we have identified a new family of putative regulatory
proteins in Arabidopsis. The specific tissue expression patterns of at
least two of the members (Campisi et al., 1999 ) suggest a role for some
of the encoded proteins in the regulation of the vegetative to
reproductive transition, as well as in carpel development.
Unfortunately, genetic redundancy precludes the generation of mutant
phenotypes, and the tandem array of the genes requires strategies that
allow the generation of knockouts for several genes simultaneously. We
hope that deletion of several or all the REM related genes
in BAC F28 M20 on chromosome 4 would provide information about the role of this set of genes in Arabidopsis reproductive development.
 |
MATERIALS AND METHODS |
Plant Materials and Growth Conditions
Arabidopsis plants used in this work belonged to Landsberg
erecta, Columbia (Col), and Wassilewskija-2 ecotypes.
Plants were grown at 22°C under long-day (16 h of light) or short-day
(8 h of light) conditions, at an intensity of 140 µE m 2
s 1 in a mixture of soil:vermiculite (3:1). For some
experiments, plants were grown under sterile conditions in petri dishes
containing Murashige and Skoog salts supplemented with 1% (w/v) Suc
and solidified with 0.8% (w/v) agar.
Isolation of cDNA and Genomic Clones Corresponding to
AtREM1
A cDNA library prepared from young inflorescences of Arabidopsis
(ecotype Landsberg erecta; Weigel et al., 1992 ) was
screened (5 × 105 pfu) with the CM6.2 fragment (287 bp) corresponding to the 3' end of BoREM1
(Franco-Zorrilla et al., 1999 ). Hybridization was performed at 55°C
using standard procedures (Sambrook et al., 1989 ). Eight phages giving
positive hybridization were identified, and plasmids were excised in
vivo and converted into EcoRI-XhoI inserts in pBS SK (Stratagene, La Jolla, CA). A genomic clone was
isolated from an Arabidopsis (ecotype Col) genomic DNA library in a
GEM11 (Promega, Madison, WI) after screening with the
AtREM1 cDNA using standard procedures (Sambrook et al.,
1989 ). A 4-kb EcoRI restriction fragment was cloned in
pBS KS, and different restriction fragments were subcloned for sequence
determination. The transcription start site for AtREM1
was identified by primer extension analysis (Sambrook et al., 1989 )
using the primer 5'-AATGGTTTGTCTCCGGTACG-3' for reverse transcription
and 1 µg of poly(A)+ RNA from inflorescence apices as template.
DNA Sequencing and Analysis
Sequencing was carried out using Sequenase Ver 2.0 (U.S.
Biochemical Corp., Cleveland) and synthetic primers. All sequences were
analyzed for similarity to databases using the internet site of the
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov) and The Arabidopsis
Information Resource (http://www.Arabidopsis.org), running
the BLAST programs (Altschul et al., 1990 ). Other sequence analysis and
manipulations were carried out using the PC-Gene (IntelliGenetics,
Mountain View, CA) and GCG (Genetics Computer Group, Madison, WI)
packages. To construct the phylogenetic tree, predicted proteins were
aligned with CLUSTALW, 100 bootstrapped data sets were obtained with
SEQBOOT, distance matrices were calculated with PROTDIST-Dayhoff PAM
matrix algorithm, trees were constructed with NEIGHBOR, and a consensus
tree was obtained with CONSENSE. SEQBOOT, PROTDIST, NEIGHBOR, and
CONSENSE are from the PHYLIP package (Felsenstein, 1989 ).
RNA Isolation and Analysis
Isolation of total and poly(A)+ RNA and
northern hybridizations were previously described (Franco-Zorrilla et
al., 1999 ). Minipreparations of plant RNA were performed using the
FastRNA Green Kit (Bio 101, Vista, CA) followed by a treatment with
RNase free DNaseI (Roche Molecular Biochemicals, Summerville, NJ). RNAs
were quantified and their integrity was tested in ethidium
bromide-stained agarose gels. For RT-PCR reactions, 250 ng (for 50-µL
reactions) of RNA was used as template in one-step RT-PCR reactions
with GeneAmp Thermostable rTth Reverse Transcriptase RNA PCR kit
(PerkinElmer, Norwalk, CT). First-strand synthesis was accomplished
from downstream primer 5'-CCGTCTTCTCCGATATGTTC-3'. PCR
with the same primer and the oligonucleotide 5'-TACCGGAGACAAACCATTTC-3'
subsequently allowed the amplification of a 397-bp cDNA fragment. As a
control for RT-PCR reactions, we used the AP2 gene as in
Putterill et al. (1995) . In all cases, reverse transcription was
carried out at 63°C for 30 min, followed by a PCR reaction at 94°C
for 45 s and 63°C for 45 s for 30 cycles. PCR reactions
were loaded in 1.7% (w/v) agarose gels, transferred onto Hybond
N+ membranes, and hybridized with the corresponding DNA
probes. RT-PCR experiments were performed at least twice with different RNA samples, and a representative result is presented.
In Situ Hybridization
Digoxygenin labeling of RNA probes, tissue preparation, and
hybridization were done as described by Coen et al. (1990) . The REM1 probe used was designed to prevent
cross-hybridization with other REM genes. To obtain a
3'-1,250-bp insert as a template for REM1 riboprobes
synthesis, the REM1 cDNA was digested with XbaI and religated in pBS SK. The hybridized sections
were visualized with Nomarski optics.
Transient Transformation of Onion (Allium cepa)
Epidermis Cells
The construct for transient expression was generated by fusing a
PCR-amplified full-length REM1 cDNA in frame to the GUS
reporter gene into the vector pBI221 from CLONTECH (Palo Alto, CA).
Transformation of onion epidermal cells using a PDS 1000 helium
particle gun (Bio-Rad, Hercules, CA) and histochemical staining were
performed as described in Varagona et al. (1991) .
Isolation of the Insertional T-DNA Line rem1
A total of 6,000 Arabidopsis (ecotype Wassilewskija-2)
T-DNA-tagged lines (Feldmann, 1991 ) in six pools of 1,000 lines each was PCR-screened for an insertion in REM1 with
oligonucleotides ARA6 5'-AAATTTCGTACCGGAGACAAACCATTTCTC-3' and
ARA7 5'-TCTTTGTTTCTTTCCCCATCTTCAGTCTCAC-3' corresponding to 5' and
3' ends of REM1, respectively, and LB-RB primers as in
Krysan et al. (1996) for T-DNA borders. After identification of a
positive pool, a bidimensional secondary screening (Azpiroz-Leehan and
Feldmann, 1997 ) was performed with oligonucleotides LB and ARA7 on 20 DNA pools from 100 lines each, which allowed the identification of a
10-line subpool. Seeds corresponding to 10 individual lines were grown
to isolate the rem1 mutant. PCR performed with ARA6 and
RB primers failed to amplify any fragment, probably due to a partial
deletion of the region of the right border homologous to RB primer. PCR
reactions were performed in a 2400 thermocycler (PerkinElmer) at 94°C
for 30 s, at 68°C for 1 min, and at 72°C for 1 min 30 s,
35 cycles. For RT-PCR expression studies in rem1 homozygous lines, 5 µg of total RNA from inflorescence apices was
treated with DNase and was employed in first-strand cDNA synthesis using SuperScript II (Gibco-BRL, Grand Island, NY) and an oligo T17 as primer. cDNAs were 250- and 500-fold diluted in
subsequent PCR reactions. Primers used in these experiments were ARA6
and ARA7 for REM1 expression and CTCATGGCCGCCGGATCTGA
and CTTGTCTCTCCATATCTTGAGCA corresponding to TS 1 as a control
(Berlyn et al., 1989 ).
 |
ACKNOWLEDGMENTS |
We thank the Arabidopsis Biological Resource Center, Ohio State
University (Columbus), for providing the DNA pools corresponding to the
Feldmann collection and the cDNA library, and Dr. Nigel Crawford for
supplying the genomic DNA library. We thank Dr. Thomas Jack for sharing
unpublished results and for his critical reading of the manuscript.
 |
FOOTNOTES |
Received April 4, 2001; returned for revision June 13, 2001; accepted August 11, 2001.
1
This work was supported by Comisión
Interministerial de Ciencia y Tecnologia (Spain; grant no. AGF98-0206).
Support to research activity at Centro Nacional de
Biotecnología is provided through specific agreement between
Consejo Superior de Investigaciones Cientificas and Instituto Nacional
de Investigacion y Tecnologia Agraria y Alimentaria. J.M.F.-Z. was
funded by a predoctoral fellowship from Dirección General de
Investigación Científica y Tecnológica (Spain).
B.F.-C. was a recipient of a postdoctoral fellowship from Instituto
Nacional de Investigacion y Tecnologia Agraria y Alimentaria (Spain),
and P.C. and J.A.J. are recipients of postdoctoral Ministerio de
Educación y Ciencia (Spain) contracts.
*
Corresponding author; e-mail zapater{at}cnb.uam.es; fax
34-91-5854506.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010323.
 |
LITERATURE CITED |
-
Altschul F, Gish F, Miller W, Myers EW, Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215: 403-410[CrossRef][ISI][Medline]
-
Azpiroz-Leehan R, Feldmann KA
(1997)
T-DNA insertion mutagenesis in Arabidopsis: going back and forth.
Trends Genet
13: 152-156[CrossRef][ISI][Medline]
-
Berlyn MB, Last RL, Fink GR
(1989)
A gene encoding the tryptophan synthase beta subunit of Arabidopsis thaliana.
Proc Natl Acad Sci USA
86: 4604-4608[Abstract/Free Full Text]
-
Bernier G, Havelange A, Houssa C, Petitjean A, Leujeune P
(1993)
Physiological signals that induce flowering.
Plant Cell
5: 1147-1155[Free Full Text]
-
Blanc G, Barakat A, Guyot R, Cooke R, Delseny M
(2000)
Extensive duplication and reshuffling in the Arabidopsis genome.
Plant Cell
12: 1093-1101[Abstract/Free Full Text]
-
Campisi L, Yang Y, Yi Y, Heilig E, Herman B, Cassista AJ, Allen DW, Xiang H, Jack T
(1999)
Generation of enhancer trap lines in Arabidopsis and characterization of expression patterns in the inflorescence.
Plant J
17: 699-707[CrossRef][ISI][Medline]
-
Coen ES, Romero JM, Doyle S, Elliott R, Murphy G, Carpenter R
(1990)
floricaula: a homeotic gene required for flower development in Antirrhinum majus.
Cell
63: 1311-1322[CrossRef][ISI][Medline]
-
Feldmann KA
(1991)
T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum.
Plant J
1: 71-82
-
Felsenstein J
(1989)
PHYLIP: Phylogeny Inference Package (Version 3.2).
Cladistics
5: 164-166
-
Franco-Zorrilla JM, Fernández-Calvín B, Madueño F, Cruz-Alvarez M, Salinas J, Martínez-Zapater JM
(1999)
Identification of genes specifically expressed in cauliflower reproductive meristems: molecular characterization of BoREM1.
Plant Mol Biol
39: 427-436[CrossRef][ISI][Medline]
-
Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM
(1992)
Isolation of the Arabidopsis ABI3 gene by positional cloning.
Plant Cell
4: 1251-1261[Abstract/Free Full Text]
-
Gu Q, Ferrándiz C, Yanofsky MF, Martienssen R
(1998)
The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development.
Development
125: 1509-1517[Abstract]
-
Hardtke CS, Berleth T
(1998)
The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development.
EMBO J
17: 1405-1411[CrossRef][ISI][Medline]
-
Ingram GC, Goodrich J, Wilkinson MD, Simon RD, Haughn GW, Coen ES
(1995)
Parallels between unusual floral organs and fimbriata, genes controlling flower development in Arabidopsis and Antirrhinum.
Plant Cell
7: 1501-1510[Abstract]
-
Jefferson RA, Kavanagh TA, Bevan MW
(1987)
GUS fusions:
-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
EMBO J
6: 3901-3907[ISI][Medline] -
Jofuku KD, den Boer BGW, Van Montagu M, Okamuro JK
(1994)
Control of Arabidopsis flower and seed development by the homeotic gene APETALA2.
Plant Cell
6: 1211-1225[Abstract]
-
Kagaya Y, Ohmiya K, Hattori T
(1999)
RAV1, a novel DNA binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants.
Nucleic Acids Res
27: 470-478[Abstract/Free Full Text]
-
Kempin SA, Savidge B, Yanofsky MF
(1995)
Molecular basis of the cauliflower phenotype in Arabidopsis.
Science
267: 522-525[Abstract/Free Full Text]
-
Kim Y, Zhang H, Scholl RL
(1990)
Two evolutionary divergent genes encode a cytoplasmic ribosomal protein in Arabidopsis thaliana.
Gene
93: 177-182[Medline]
-
Koornneef M, Alonso-Blanco C, Peeters AJM, Soppe W
(1998)
Genetic control of flowering time in Arabidopsis.
Annu Rev Plant Physiol Plant Mol Biol
49: 43-48
-
Krysan PJ, Young JC, Tax F, Sussman MR
(1996)
Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA
93: 8145-8150[Abstract/Free Full Text]
-
Lee H, Suh SS, Park E, Cho E, Ahn JH, Kim SG, Lee JS, Kwon YM, Lee I
(2000)
The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis.
Genes Dev
14: 2366-2376[Abstract/Free Full Text]
-
Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD, Fujii CY, Mason T, Bowman C, Barnstead M, et al
(1999)
Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana.
Nature
402: 761-768[CrossRef][Medline]
-
Luerssen K, Kirik V, Herrmann P, Misera S
(1998)
FUSCA3 encodes a protein with a conserved VP1/ABI3-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana.
Plant J
15: 755-764[CrossRef][ISI][Medline]
-
Lütcke HA, Chow KC, Mickel FS, Moss KA, Kern HF, Scheele GA
(1987)
Selection of AUG initiation codons differs in plants and animals.
EMBO J
6: 43-48[ISI][Medline]
-
Mandel MA, Gustafson-Brown C, Savidge B
(1992)
Molecular characterization of the Arabidopsis floral homeotic gene APETALA1.
Nature
360: 273-277[CrossRef][Medline]
-
Mandel MA, Yanofsky MF
(1995)
The Arabidopsis AGL8 MADS box gene is expressed in the inflorescence meristems and is negatively regulated by APETALA1.
Plant Cell
7: 1763-1771[Abstract]
-
Mayer K, Schuller C, Wambutt R, Murphy G, Volckaert G, Pohl T, Dusterhoft A, Stiekema W, Entinn KD, Terryn N, et al
(1999)
Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana.
Nature
402: 769-777[CrossRef][Medline]
-
McCarty DR, Hatori T, Carson CB, Vasil V, Lazar M, Vasil IK
(1991)
The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator.
Cell
66: 895-905[CrossRef][ISI][Medline]
-
Menzel G, Apel K, Melzer S
(1996)
Identification of two MADS box genes that are expressed in the apical meristem of the long-day plant Sinapis alba in transition to flowering.
Plant J
9: 399-408[CrossRef][ISI][Medline]
-
Mitchell PJ, Tjian R
(1989)
Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins.
Science
245: 371-378[Abstract/Free Full Text]
-
Okamuro JK, Caster B, Villarroel R, Van Montagu M, Jofuku KD
(1997)
The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis.
Proc Natl Acad Sci USA
94: 7076-7081[Abstract/Free Full Text]
-
O'Shea EK, Rutkowski R, Kim PS
(1989)
Evidence that the leucine zipper is a coiled coil.
Science
243: 538-542[Abstract/Free Full Text]
-
Piñeiro M, Coupland G
(1998)
The control of flowering time and floral identity in Arabidopsis.
Plant Physiol
117: 1-8[Free Full Text]
-
Poethig RS
(1990)
Phase change and the regulation of shoot morphogenesis in plants.
Science
250: 923-930[Abstract/Free Full Text]
-
Putterill J, Robson F, Lee K, Simon R, Coupland G
(1995)
The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors.
Cell
80: 847-857[CrossRef][ISI][Medline]
-
Raikhel N
(1992)
Nuclear targeting in plants.
Plant Physiol
100: 1627-1632[Free Full Text]
-
Sablowski RWM, Meyerowitz EM
(1998)
A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA.
Cell
92: 93-103[CrossRef][ISI][Medline]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Schmidt R
(2000)
Synteny: recent advances and future prospects.
Curr Opin Plant Biol
3: 97-102[CrossRef][ISI][Medline]
-
Sessions A, Nemhauser JL, McColl A, Roe JL, Feldmann KA, Zambryski PC
(1997)
ETTIN patterns the Arabidopsis floral meristem and reproductive organs.
Development
124: 4481-4491[Abstract]
-
Simpson GG, Gendall AR, Dean C
(1999)
When to switch to flowering.
Annu Rev Cell Dev Biol
15: 519-550[CrossRef][ISI][Medline]
-
Smyth DR, Bowman JL, Meyerowitz EM
(1990)
Early flower development in Arabidopsis.
Plant Cell
2: 755-767[Abstract/Free Full Text]
-
Suzuki M, Kao CK, McCarty D
(1997)
The conserved domain of VIVIPAROUS1 has a cooperative DNA binding activity.
Plant Cell
9: 799-807[Abstract]
-
Ulmasov T, Hagen G, Guilfoyle TJ
(1997)
ARF1, a transcription factor that binds to auxin response elements.
Science
276: 1865-1868[Abstract/Free Full Text]
-
Ulmasov T, Hagen G, Guilfoyle TJ
(1999)
Dimerization and DNA binding of auxin response factors.
Plant J
19: 309-319[CrossRef][ISI][Medline]
-
Varagona MJ, Schmidt RJ, Raikhel NV
(1991)
Monocot regulatory protein Opaque-2 is localized in the nucleus of maize endosperm and transformed tobacco plants.
Plant Cell
3: 105-113[Abstract/Free Full Text]
-
Weigel D, Alvarez J, Smyth DR, Yanofsky MF, Meyerowitz EM
(1992)
LEAFY controls floral meristem identity in Arabidopsis.
Cell
68: 843-859
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
M. Schmid, N. H. Uhlenhaut, F. Godard, M. Demar, R. Bressan, D. Weigel, and J. U. Lohmann
Dissection of floral induction pathways using global expression analysis
Development,
December 15, 2003;
130(24):
6001 - 6012.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|