|
|
||||||||
|
Plant Physiol, February 2001, Vol. 125, pp. 1001-1011
Characterization of Plant
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Pyrimidine bases are rapidly catabolized in growing plant tissues.
The final enzyme of the catabolic pathway,
-ureidopropionase (
-UP; EC 3.5.1.6), was partially purified from the shoots of etiolated maize (Zea mays) seedlings. The enzyme had a
Km for
-ureidopropionate (the substrate
derived from uracil) of 11 µM. Only one enantiomer of
racemic
-ureidoisobutyrate (derived from thymine) was processed with
a Km of 6 µM. The enzyme was
inactivated by dialysis against 1,10-phenanthroline and activity could
be partially restored by addition of Zn2+. Maize
-UP was
very sensitive to inactivation by iodoacetamide. This could be
prevented by addition of substrate, indicating the presence of an
active site Cys. The enzyme was strongly inhibited by short chain
aliphatic acids and aryl propionates, the most potent inhibitor of
which was 2-(2, 6-dinitrophenoxy)-propionate (I50 = 0.5 µM). A gene
for Arabidopsis
-UP encodes a polypeptide of 405 amino acids and has
about 55% homology with the enzymes from other eukaryotic organisms.
Several highly conserved residues link the plant
-UP with a larger
class of prokaryotic and eukaryotic amidohydrolases. An Arabidopsis
cDNA truncated at the N terminus by 14 residues was cloned and
overexpressed in Escherichia coli. The recombinant
enzyme (43.7 kD) was soluble, functional, and purified to homogeneity
with yields of 15 to 20 mg per 30 g fresh weight of E.
coli cells. The recombinant enzyme from Arabidopsis and the
native enzyme from maize had molecular masses of approximately 440 kD,
indicating the enzyme is a decamer at pH 7.
| |
INTRODUCTION |
|---|
|
|
|---|
Plant cells can efficiently
catabolize uracil, thymine, uridine, and thymidine to
CO2, ammonia, and small amino acids (Barnes and
Naylor, 1962
; Tsai and Axelrod, 1965
; Lesley et al., 1980
; Slabas et
al., 1980
). Although there are pathways to recover pyrimidine bases and
nucleosides, their predominant metabolic fate in plant cells appears to
be catabolic. This is in contrast to the efficient and
well-characterized salvage of the purine, adenine (Ashihara et al.,
2000
). The presence of this degradative activity for pyrimidines accounts for the relatively poor incorporation of exogenous
radiolabeled thymidine into DNA in dividing plant cells (Lesley et al.,
1980
; Slabas et al., 1980
). The pathway for the catabolism of
pyrimidine bases is widespread and has been found in many eukaryotic
and prokaryotic organisms (Wasternack, 1978
). It consists of three steps, a reduction of the pyrimidine ring catalyzed by
dihydropyrimidine dehydrogenase followed by a ring-opening hydrolysis
catalyzed by dihydropyrimidinase, then hydrolysis of the resulting
ureide group by
-ureidopropionase (
-UP, EC 3.5.1.6; also called
-Ala synthase or N-carbamoyl-
-Ala amidohydrolase in
some studies) to produce CO2, ammonia, and a
-amino acid (Fig. 1). The end product of the pathway derived from uracil is
-Ala and from thymine is
-aminoisobutyrate. In the organisms so far tested each enzyme of
the pathway can process the substrates derived from uracil and
thymine.
|
The pyrimidine catabolic pathway has been investigated in most
detail in mammalian liver where it is responsible for the inactivation of the anticancer drug, 5-fluorouracil (Wasternack, 1980
). However, almost no characterization of the pathway components has been reported
in plants. Although the pathway is generally characterized as
catabolic, it also acts as a significant biosynthetic source of
-Ala. In mammals
-Ala has a physiological role in
neurotransmission and is a component of neural dipeptides such as
carnosine and anserine. As a consequence, genetic disruptions in normal
-Ala metabolism can lead to severe neurological problems (Traut and Jones, 1996
). In plants
-Ala is an essential component of the pantothenate moiety of coenzyme A. The betaine derivative of
-Ala is
also a primary osmoprotectant in some plant families such as the
Plumbaginacae (Rathinasabapathi et al., 2000
). The pyrimidine catabolic pathway may therefore be a significant source of
-Ala for
these important compounds in plants.
Our interest in the pyrimidine catabolic pathway was stimulated by
noting the rapid and extensive release of
14CO2 from the addition of
uracil or thymine labeled at C-2 to plant tissues during investigations
of plant pyrimidine metabolism. This, combined with the potential
importance of
-Ala as a biosynthetic precursor for pantothenate,
prompted us to characterize the key enzyme in the pathway responsible
for the release of CO2 and production of
-Ala
from pyrimidines,
-UP. The enzyme has previously been studied from
some microbes including Euglena gracilis (Wasternack et al., 1979
; Ogawa and Shimizu, 1994
) and from mammalian liver (Tamaki
et al., 1987
; Matthews et al., 1992
). Genes encoding the rat and human
-UPs have been isolated and characterized (Kvalnes-Krick and Traut,
1993
; Vreken et al., 1999
). The rat enzyme has a subunit molecular mass
of 42 kD and in the native state is a hexamer of 240 kD. However, the
enzyme undergoes significant changes in oligomerization state in the
presence of substrate or product that may also act as regulatory
mechanisms. For example, it associates to a more active decamer or
dodecamer (410-430 kD) in response to low concentrations of
-ureidopropionate (Matthews and Traut, 1987
). In common with some
other amidohydrolases, rat
-UP appears to be a
Zn2+-dependent enzyme (Kvalnes-Krick and Traut,
1993
).
In contrast to the mammalian enzyme, very few details regarding the
enzyme from higher plants are available, although the pathway is
clearly very active in plant tissues. In this study we have
characterized the native
-UP from maize (Zea mays),
cloned an Arabidopsis cDNA encoding
-UP, and functionally
over-expressed the enzyme at high levels in Escherichia
coli. This is the first detailed characterization of an enzyme
synthesizing
-Ala in plants.
| |
RESULTS |
|---|
|
|
|---|
Native
-UP Characterization
Figure 2 shows the release of
14CO2 when etiolated maize
shoots are incubated with increasing concentrations of exogenous
pyrimidines labeled in the C-2 position. Thymine was more efficiently
processed by the pathway than uracil, as it produced a consistently
higher rate of 14CO2
release than uracil, similar to previous studies in E. gracilis (Wasternack et al., 1977
). Dihydrouracil also produced a
higher rate of CO2 release than uracil,
suggesting that the first reductive step in the pathway may be somewhat
rate-limiting in these conditions. Similar experiments with Arabidopsis
seedlings showed even higher rates of CO2 release
from pyrimidines on a gram fresh weight basis (data not shown).
However, etiolated maize shoots were chosen as the preferred source for
enzyme isolation as large amounts of tissue could be grown that
contained high levels of
-UP without significant interference from
photosynthetic pigments. Partially purified preparations of
-UP that
were isolated from etiolated maize shoots by ammonium sulfate
precipitation and anion-exchange chromatography proved to be quite
stable. There was only about 10% loss in activity after storage for
7 d at 4°C in the presence of Mg2+ and
dithiothreitol (DTT). The enzyme preparations were stable for several
months when frozen at
70°C in the presence of 10% (w/v)
glycerol.
|
Maize
-UP had a Km value of 11 µM for
-ureidopropionate (Fig.
3A).
-Ureidoisobutyrate was also a
substrate for the enzyme, and was a competitive inhibitor of the
reaction with
-ureidopropionate (data not shown). The radiolabeled
-ureidoisobutyrate synthesized for the experiments was racemic, so
we first determined if maize
-UP had a stereospecific
preference by adding a large excess of the enzyme to a sample of
racemic [6-14C]
-ureidoisobutyrate. Table
I shows that a maximum of just under 50%
of the racemic substrate could be hydrolyzed by the enzyme strongly,
suggesting that only one enantiomer of
-ureidoisobutyrate is a
competent substrate. In contrast, almost 90% of the non-chiral substrate
-ureidopropionate was hydrolyzed under the same
conditions. The unhydrolyzed enantiomer of
-ureidoisobutyrate may
account for the enzyme inhibition seen at high substrate concentrations of racemic
-ureidoisobutyrate seen in Figure 3B. Using the data points measured at low concentrations, a Km
value of 6 µM for the active
-ureidoisobutyrate enantiomer was determined. To eliminate issues of
chirality,
-ureidopropionate was used as the primary substrate for
further analysis of
-UP activity.
|
|
The pH optimum for the enzyme was broad at mildly acidic pH values as there was little change in the level of enzyme activity between pH values of 6.0 to 7.2. However, enzyme activity declined at more alkaline pH values. The native molecular mass of the enzyme was estimated to be 440 ± 40 kD by size exclusion chromatography (Fig. 4).
|
Effect of Metal Ion Chelators
To assess whether maize
-UP is a
Zn2+-requiring enzyme like the mammalian enzyme
(Kvalnes-Krick and Traut, 1993
), the enzyme was extensively dialyzed
against buffer solutions containing several different metal ion
chelators at 1 mM concentrations. The chelators were then
removed by further dialysis against buffer alone and the residual
enzyme activity was measured. Dialysis against EDTA, 2,6-dipicolinic
acid, or 8-hydroxyquinoline lowered the enzyme activity by 56%, 33%,
and 29%, respectively, relative to a control, whereas
1,10-phenanthroline lowered the activity by 96%. Enzyme that had been
completely inactivated by treatment with 1,10-phenanthroline could be
reactivated by addition of 20 µM
Zn2+. After 5 h, 30% of the original enzyme
activity was recovered and after 24 h, 46% was recovered. This
suggests that maize
-UP is a Zn2+-dependent enzyme.
Effect of Thiol Reagents
-UP from maize was very sensitive to inhibition by thiol
derivatizing reagents. Addition of 200 µM
Cu2+ ion, 1 mM iodoacetamide, or
p-chloromercuribenzene-sulfonic acid completely
eliminated the activity of the enzyme. Further experiments showed that
addition of 75 µM iodoacetamide for 30 min was
sufficient to completely inactivate the enzyme. Inhibition by
iodoacetamide was completely prevented by addition of substrate (Fig.
5), indicating that the sensitive thiol
group is at the active site of the enzyme.
|
Inhibitor Studies
A variety of compounds were tested as probes of the mechanism or
substrate recognition of
-UP. Hydroxamates and benzenesulfonamides can be effective inhibitors of metal ion-dependent hydrolases through
interaction with the metal ion, but none of the examples tested
(hydroxyurea, acetohydroxamic acid, benzene sulfonamide, 4-carboxybenzene-sulfonamide, or 4-nitrobenzenesulfonamide)
inhibited maize
-UP at concentrations up to 1 mM. An
aminophosphoramide and an aminosulfonamide analog of the substrate were
tested as mimics of a possible transition state for hydrolysis (Fig.
6). Similar compounds can be extremely
potent inhibitors of certain peptide hydrolases (Hanson et al., 1989
),
however these analogs were also poor inhibitors of plant
-UP. In
contrast to the mechanism-based inhibitors that we tested, a number of
short chain aryl carboxylic acids were surprisingly effective
inhibitors of
-UP. I50 values for
several of these compounds are shown in Table
II. For example, 3-phenylpropionate had
an I50 value of 5.6 µM. (S)-2-phenylpropionate was also an
effective inhibitor of the enzyme (I50 = 5.7 µM), whereas the (R)-enantiomer was 20-fold
less potent (I50 = 115 µM). The most potent inhibitor we discovered
was 2-(2, 6-dinitrophenoxy)-propionate. This compound had an
I50 of 0.5 µM and
the inhibition was completely reversible by passing the
enzyme-inhibitor complex over a gel filtration column. Several short
chain aliphatic acids also inhibited
-UP, with progressively weaker
inhibition observed with extended chain lengths (Table II). The
aliphatic acid portion of the substrate appears to significantly
contribute to substrate recognition, whereas mimics of the ureide
portion of substrate (urea and N-methylurea) were
ineffective as inhibitors of the enzyme. Several substrate analogs such as
-ureidopropionate,
-ureidoisobuty-rate,
-ureido-n-butyrate, N-carbamyl-Asp, and the reaction
products
-Ala and
-ureidoisobutyrate had no effect on enzyme
activity at concentrations up to 2 mM.
|
|
Arabidopsis
-UP cDNA Cloning and Overexpression
The published amino acid sequence of
-UP from rat liver
(Kvalnes-Krick and Traut, 1993
; GenBank accession no. Q03248) was used
to identify a homologous Arabidopsis expressed sequence tag (EST;
GenBank accession no. F20060). The EST was obtained from the
Arabidopsis Biological Resource Center and was completely sequenced.
The EST encoded a polypeptide of 392 amino acids, but no starting Met
residue was apparent. However, alignment with the rat
-UP and a
-UP sequence from Caenorhabditis elegans (GenBank accession no. AAC46683) showed that the coding sequence completely
overlapped these sequences (Fig. 7). An
open reading frame (ORF) was therefore constructed by inserting an ATG
codon at the beginning of the Arabidopsis EST. This eliminated the
first three amino acid residues and replaced them with a Met residue to
create an ORF encoding a polypeptide of 390 amino acids. An ORF with an
identical sequence to the EST subsequently emerged from the Arabidopsis
genomic sequencing project located on chromosome 5 (Nakamura et al.,
1997
; GenBank accession no. BAB09868). Inspection of this ORF indicated
that the EST sequence was missing 13 N-terminal amino acids (shown in
Fig. 7).
|
The truncated Arabidopsis gene was inserted into a pET24d expression
vector and overexpressed in E. coli BL21 using T7 RNA polymerase directed expression after induction by
isopropylthio-
-galactoside (Studier et al., 1990
). Extracts from
these E. coli contained high levels of
-UP activity,
indicating that truncation of the amino acid sequence by 15 residues
did not inactivate the enzyme activity. Purification of the recombinant
-UP routinely produced 15 to 20 mg of
-UP from 30 g wet
weight of E. coli cells, with a final purity of >90% as
judged by SDS-PAGE analysis (Fig. 8). The
identity of the purified polypeptide was confirmed by accurate determination of the molecular mass of the purified protein by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The experimentally measured molecular mass was 43,723.1 g/mol, which compared favorably with the theoretical value of 43,732.8 g/mol. The molecular masses of 13 tryptic peptides from the purified
protein also closely agreed with the theoretical fragment masses
calculated from the deduced amino acid sequence (data not
shown).
|
The addition of a thiol-reducing agent such as DTT was essential to
maintain catalytic activity of recombinant
-UP and addition of
glycerol to the buffers after the Mono Q chromatography step also
increased the stability of the enzyme activity, similar to observations
made for rat liver
-UP (Tamaki et al., 1987
). The purified
recombinant protein had a specific activity of 30 nmol min
1 mg
1 protein at a
substrate concentration of 8 µM. This was significantly higher than the activity obtained from corn seedlings. There was some
loss of overall activity during purification so this value does not
represent the maximum specific activity. Attempts at purifying the
protein by hydrophobic interaction chromatography column greatly
reduced the recovery and specific activity of the enzyme. This lability
may be associated with the hydrophobic properties noted for the rat
enzyme (Matthews et al., 1992
).
Isoelectric focusing of purified recombinant Arabidopsis
-UP gave a
single band of pI 6.2 (compared with a value of 6.6 calculated from the
deduced amino acid sequence). Size-exclusion chromatography indicated
that the molecular mass of the recombinant enzyme at pH 7.3 (in the
presence of 5% [v/v] glycerol) was similar to that of the native
maize enzyme (>400 kD). Higher oligomeric species were also observed
that eluted toward the void volume of the Superose 6 columns. Native
PAGE analysis of these fractions showed three high molecular mass bands
were present, but they contained a single 43-kD band by SDS-PAGE,
suggesting the presence of higher aggregation states of
-UP (data
not shown). Size-exclusion chromatography at pH 5.6 in the absence of
glycerol gave a single peak corresponding to a dimer (approximately 90 kD).
| |
DISCUSSION |
|---|
|
|
|---|
Maize seedlings contained high levels of the pyrimidine catabolic
pathway and were a convenient source of
-UP. It appears that most
actively growing plant tissues have substantial pyrimidine catabolic
capacity, as high levels of pathway activity were also found in
Arabidopsis seedlings, and other workers have noted active pathways in
a variety of other species (Wasternack, 1978
; Ashihara et al., 2000
).
Despite the ubiquitous presence of the pathway in plants, its vital
function is unclear. It may simply serve to recycle carbon and nitrogen
from pyrimidine bases during conditions of high DNA and RNA turnover in
actively dividing tissue. However, one end-product of the pathway,
-Ala, is an important constituent of pantothenate and coenzyme A and
the betaine derivative of
-Ala is a primary osmoprotectant in some
plant families such as the Plumbaginacae (Rathinasabapathi et
al., 2000
).
-Ala can potentially be synthesized via other pathways
such as decarboxylation of Asp or transamination of malonate
semialdehyde, but several studies have been unable to detect any
-decarboxylation of Asp in tissues from a variety of plant species
(Naylor et al., 1958
; Barnes and Naylor, 1962
; Rathinasabapathi et al.,
2000
). The amino acid derived from thymine,
-ureidoisobutyrate, has
no known significant metabolic function. In mammalian metabolism the
level of excreted
-ureidoisobutyrate is used as an indicator of DNA
turnover via thymine degradation (Nielsen et al., 1974
), and it would
be of interest to ascertain whether
-ureidoisobutyrate levels in
plant tissues are similarly correlated.
Our characterization of
-UP from maize indicated that the native
enzyme was relatively large, having an estimated molecular mass of 440 kD. The recombinant enzyme also had a similar high molecular mass, and
size-exclusion chromatography and native PAGE analysis indicated the
presence of even higher oligomerization states. Based on a subunit
molecular mass of 44 kD, this suggests that the native enzyme is at
least a decamer. This is larger than native rat
-UP (240-kD
hexamer), but is similar in size to the rat enzyme in the presence of
substrate (Matthews et al., 1992
). Thus, the native state of the plant
enzyme appears to be at a high oligomerization state and does not
require substrate or product to induce this level of subunit
oligomerization, as has been found with the rat enzyme (Matthews and
Traut, 1987
).
The enzyme exhibited a strict stereospecific preference for one
enantiomer of the thymine-derived substrate
-ureidoisobutyrate. Thus, only one enantiomer of the product
-isobutyrate is likely to
be formed from the pyrimidine catabolic pathway in vivo. In the
mammalian liver, both preceding enzymes of the pathway have been shown
to have a stereospecific preference to eventually yield the R isomer of
-ureidoisobutyrate (Gani and Young, 1983
; Kikugawa et al., 1994
).
The stereospecificity of plant
-UP was also manifested in the effect
of chiral inhibitors, for example R-2-phenylpropionate was 20-fold more
inhibitory than the S-enantiomer.
We were interested in finding inhibitors of
-UP that would be useful
to probe the in vivo metabolic function of the enzyme and give clues as
to its biochemical mechanism. The inactivation of
-UP by
1,10-phenanthroline and its subsequent reactivation by added
Zn2+ suggest that maize
-UP requires this
metal ion as a catalytic cofactor. Hydroxamates and benzene
sulfonamides are often inhibitors of hydrolases that cleave amide or
urea bonds using a non-redox-active divalent metal ion such as
Zn2+ as a cofactor. Examples are urease, a
Ni2+-containing hydrolase (Dixon et al., 1980
),
Zn2+-containing metalloproteases (Browner et al.,
1995
), and dihydropyrimidinase, the preceding enzyme in the pyrimidine
catabolic pathway, which is a Zn2+-containing
hydrolase (Brooks et al., 1983
). However, the compounds that we tested
did not inhibit maize
-UP significantly, suggesting that
-UP is
mechanistically different from these amidohydrolases or that the
Zn2+ is more inaccessible to the inhibitors. We
also reasoned that the enzyme may hydrolyze the ureide group via a
hydroxylated tetrahedral intermediate equivalent to metal ion-assisted
mechanisms of peptide hydrolysis (Hanson et al., 1989
), but mimics of
this transition state were also not inhibitory. This could be because
the active site Cys may be used as a nucleophile to generate a
thioadduct tetrahedral intermediate rather than the ureide being
directly attacked by hydroxide. This mechanism has been proposed
for two enzymes catalyzing similar ureide hydrolysis reactions,
N-carbamoylsarcosine amidohydrolase (Romao et al., 1992
) and
N-carbamoyl-D-amino acid amidohydrolase (Nakai et al., 2000
). It is interesting that neither of
these enzymes has been reported to contain a metal ion cofactor. The
best inhibitors of maize
-UP were simple aliphatic acids and
arylpropionic acids, suggesting that
-UP primarily recognizes the
acidic portion of the substrate and the aryl groups of these inhibitors may occupy the ureide binding region.
The published sequence of rat
-UP was used to identify an
Arabidopsis EST encoding a putative
-UP that encoded a truncated polypeptide of 392 residues. Subsequent to our cloning and
overexpression of this protein, an ORF identical to the EST was
identified from the Arabidopsis genome sequencing project encoding a
polypeptide of 405 residues. The
-UP we overexpressed was truncated
by 14 amino acid residues, but the protein was functional, soluble, and
as stable as the native protein indicating that these residues are not
required for activity. The N-terminal residues do not appear to have
the characteristics of a transit peptide, which is consistent with the
reported cytosolic subcellular location of the enzyme in tomato cell
cultures (Tintemann et al., 1987
).
Alignment of the Arabidopsis
-UP amino acid sequence with sequences
from rat
-UP and a putative
-UP from the nematode genome show
that 55% to 61% of residues are conserved, respectively, particularly
in the central portion of the sequences (Fig. 7). Several ESTs with
high degrees of homology to the Arabidopsis
-UP sequence can also be
identified from cotton, soybean, tomato, oat, and rice using BLAST
searches of EST databases in GenBank, indicating that the enzyme is
widespread and well conserved in plants. An additional cDNA sequence
encoding a 300-amino acid residue polypeptide from tomato (GenBank
accession no. CAB45873) has been annotated as a putative
-UP, but
this sequence had significantly lower homology (25% identity) to all
of the other
-UP sequences, including the ones from plants.
This suggests that this tomato protein may not be a true
-UP,
but perhaps is a closely related ureidohydrolase with a different
substrate specificity.
The sequences of
-UPs from many organisms are quite highly
conserved. However, there is weaker, but significant, homology to a
larger class of enzymes that include nitrilases, cyanide hydratases,
some aliphatic amidases, and some ureidohydrolases (Bork and Koonin,
1994
; Novo et al., 1995
). These enzymes all catalyze the hydrolysis of
carbon-nitrogen bonds to release ammonia and the corresponding acid.
Residues that are completely conserved within this class of enzymes are
highlighted in Figure 7. This homology is centered around a conserved
Cys that has been shown by site directed mutagenesis studies to be
essential for catalytic activity (Novo et al., 1995
). Based on the
recently published crystal structure of
N-carbamoyl-D-amino acid
amidohydrolase from Agrobacterium sp. (Nakai et al., 2000
),
this conserved Cys residue forms a catalytic triad with an adjacent Glu
and Lys residue in the active site of the enzyme. The homologous
residues in the Arabidopsis
-UP sequence are Cys-246, Glu-134, and
Lys 209, and these residues are also conserved in other
-UP
sequences (Fig. 7). As a consequence, it is likely that Cys-246 is the
active site thiol that is susceptible to iodoacetamide modification in our studies.
The presence of the conserved residues of the amidohydrolase class of
enzymes accounts for the weak, but significant, homology of
-UP to
many plant nitrilases such as those hydrolyzing indoleacetonitrile to
indoleacetic acid. The mechanism of hydrolysis employed by auxin-producing nitrilases is therefore likely to be similar to that of
-UP and other members of this class of amidohydrolases, although the
substrates are superficially quite different. These overlapping
mechanisms may allow for the design of specific inhibitors or mutated
enzymes with altered potencies or specificities that could affect many
aspects of plant metabolism.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plants
Maize (Zea mays) was grown at 25°C for 5 to 8 d in potting soil under a black cloth sheet or in a darkroom to induce etiolation.
Reagents
[2-14C]Uracil, [2-14C]thymine,
[2-14C]dihydrothymine, and potassium
[14C]cyanate were purchased from Moravek Biochemicals
(Brea, CA) or New England Nuclear (Boston) with initial specific
activities of about 56 mCi mmol
1.
2-Aminosulfonamidoxypropionic acid and
2-aminophos-phoramidoxypropionic acid were provided by Dr. M. Hopkins and 2-(2, 6-dinitrophenoxy)-propionic acid was provided
by R. Johnston of Dow AgroSciences Agricultural Chemical Discovery
Research (Indianapolis). All other chemicals were purchased from Sigma
Chemical (St. Louis).
Partial Purification of Maize
-UP
Shoot tissue from 5- to 8-d-old etiolated maize seedlings
(approximately 250 g) was homogenized in 3 volumes of 0.1 M potassium phosphate, pH 7.0, 1 mM
MgCl2, and 2 mM DTT (buffer A). The homogenate was filtered through four layers of cheesecloth and was made 30% (w/v) in ammonium sulfate. After standing for 20 min, the
homogenate was centrifuged. The pellet was discarded and the
supernatant made 55% (w/v) in ammonium sulfate. After standing for 20 min, the suspension was centrifuged. The supernatant was discarded and
the pellet was dissolved in 20 mM Tris, pH 7.2, 1 mM MgCl2, and 2 mM DTT (buffer B).
The solution was dialyzed overnight in a 50,000-kD cut-off dialysis
membrane against three changes of 2 L of buffer B. The dialysate was
clarified by centrifugation and the supernatant was applied to a
2.5 × 15 cm column of diethylaminoethyl-Sepharose equilibrated in
buffer B. The column was washed with 45 mL of buffer B at 1.5 mL/min,
and was then eluted with 0% to 100% gradient of 0.5 M KCl
in buffer B over 4 h at the same flow rate. Fractions of 5 mL were
collected and assayed for
-UP activity. Active fractions (eluting at
buffer volumes of 200-240 mL after gradient initiation) were pooled
and concentrated in a CentriPrep-100 (Amicon, Beverly, MA) to
approximately 3 mL. The pooled, concentrated enzyme was made 10% (v/v)
in glycerol, frozen at
70°C, and was used for
-UP assays and
characterization. All steps were performed at 4°C.
The molecular mass of maize
-UP was estimated by applying a 0.5-mL
sample of partially purified
-UP onto a Superose 12 column (Pharmacia, Piscataway, NJ) equilibrated in buffer A at a flow-rate of
0.4 mL/min. Fractions of 0.4 mL were collected and assayed for
-UP
activity. The column was calibrated under the same elution conditions
with Bio-Rad (Hercules, CA) native Mr standards.
Synthesis of 14C-Labeled Substrates
A convenient and accurate method to assay
-UP activity is to
monitor the release of radiolabeled CO2 from substrate
labeled in the ureido group. Preparation of
[5-14C]
-ureidopropionate was based on the method
described in Traut and Loechel (1984)
. In a screw-top Eppendorf vial,
0.02 mL of 0.5 M
-Ala was mixed with 0.02 mL of 0.5 M [14C]potassium cyanate (5.6 mCi
mmol
1) and was incubated at 50°C for 3 h. The
solution was then spotted on to silica thin-layer chromatography plates
(2.5 µL/lane) and the plates were developed in 70% (v/v)
isopropanol/water. [5-14C]
-Ureidopropionate was
located by phosphorimaging of the plate using a phosphorimager
(Molecular Dynamics, Sunnyvale, CA) and the spots were scraped off and
eluted with four washes of 70% (v/v) isopropanol/water. The solution
was concentrated under vacuum to approximately 1 mL and stored at
20°C. A similar protocol using
-aminoisobutyrate as starting
material was used to synthesize racemic
[6-14C]
-ureidoisobutyrate. Both radiolabeled
substrates were greater than 98% pure by thin-layer chromatography analysis.
Radiometric Assay of
-UP
-UP assays were performed at 25°C by mixing 0.94 mL of
buffer A, 0.02 mL of
-ureidopropionase extract, and 0.02 mL of a test solution in a 20-mL scintillation vial. The mixture was
pre-equilibrated for 30 min and the reaction was initiated by addition
of 0.02 mL of [5-14C]
-ureidopropionate (approximately
100,000 dpm, 5.7 mCi mmol
1, corresponding to a final
substrate concentration of 8 µM in the assay). The vial
was immediately capped with a rubber septum that had a small plastic
well (Kontes part no. 882320) containing 0.05 mL of 4 N KOH
attached to it. The reaction vials were incubated at 30°C for 30 min,
then 0.25 mL of 4 N perchloric acid was injected into the
vial using a repeating pipettor with a needle attached. The vials were
incubated for a further 20 min, the septum was removed, and the well
was placed into another scintillation vial containing 15 mL of
Hionic-Fluor (Packard, Meriden, CT). After thorough shaking, the vials
were counted in a liquid scintillation counter to quantitate the amount
of 14CO2 released. (Background reactions
containing no enzyme additions were run in all experiments and
subtracted from the enzyme reaction values. Nonenzymatic decomposition
was routinely less than 0.5% of the added radioactivity.)
Concentrations that inhibited the reaction by 50%
(I50 values) were determined using a
dilution series of test compounds in this assay. Standard kinetic
analyses and curve-fitting to derive kinetic constants was done using
Grafit 4 (Erithacus Software Ltd., Staines, UK).
Although the radiometric 14CO2 capture assay
was accurate and sensitive, it was not convenient for the rapid
determination of enzyme activity in large numbers of samples (e.g.
column fractions) due to the manipulations involved in assembling the
vials with septa and CO2 trapping wells. A simpler,
qualitative assay format was devised that monitored the depletion of
substrate as follows: 65 µL of the solution to be assayed was placed
in a 7-mL scintillation vial and 65 µL of buffer A was added. The
reaction was started by addition of 20 µL of
[5-14C]
-ureidopropionate (approximately 10,000 dpm; 5.7 mCi/mmol). The vials were incubated at 30°C for 30 min, then
0.05 mL of 4 N perchloric acid was added. After leaving the
vials uncapped in a fume hood for 30 min to allow
14CO2 to be released, 5 mL of scintillation
cocktail was added to the vials, mixed thoroughly, and the residual
radioactivity was counted in a liquid scintillation counter for 1 min.
The presence of enzyme activity could be readily determined by the
reduction in the amount of residual substrate remaining in the vial.
Protection of
-UP from Iodoacetamide Modification
A sample of partially purified maize
-UP was exchanged into
0.1 M potassium phosphate, pH 7, by passage over a PD10
column (Pharmacia) to remove reductants. Then iodoacetamide was added to 1 mM final concentration in the presence or absence of
10 mM
-ureidopropionate. After 30 min, DTT was
added to 10 mM final concentration and the samples were
dialyzed against two changes of 2 L of buffer A. The samples were then
assayed for
-UP activity. Control samples untreated with
iodoacetamide were run in parallel.
In Vivo Assay of the Pyrimidine Catabolic Pathway
Five-day-old etiolated maize shoots were sliced into 3- to 5-mm segments and briefly vacuum infiltrated with water. Two hundred milligrams fresh weight of tissue was then placed in 20-mL scintillation vials containing 4 mL of water and 0.4 µCi [2-14C]uracil, thymine, or dihydrothymine was added. The vial was immediately capped with a rubber septum that had a well containing 0.04 mL of 4 M KOH attached to it. The reaction vials were incubated at 30°C for 2 h, then 1 mL 4 M perchloric acid was injected into the vial using a repeating pipettor with a needle attached. The vials were incubated for a further 30 min, then the septum was removed, and the well was placed into a scintillation vial containing 15 mL Hionic-Fluor. After thorough shaking, the radioactivity in the vials was counted in a liquid scintillation counter to quantitate the amount of CO2 released.
Gene Cloning and Overexpression of Arabidopsis
-UP
An Arabidopsis EST with significant homology to rat
-UP was
obtained from the Arabidopsis Biological Resource Center (Columbus, OH;
stock no. ATTS6099) and was completely sequenced. DNA from this clone
was purified and the insert was PCR amplified using the forward primer
TCTTCTCATATGTATGATTCGCTGCATCAA and the reverse primer
AGAAGAGTCGACTTATGTAGAATTCTTGTG. This added a Met codon and an
NdeI restriction site to the 5' end of the gene and a
SalI restriction site to the 3' end. It also deleted the
nucleotides ATTTGCGGC from the 5' end of the coding sequence of the
EST. The amplified fragment was inserted into the intermediate vector
pCR 2.1 (Invitrogen, Carlsbad, CA) and was then transferred as an NdeI/SalI fragment into the expression
vector pET24a (Novagen, Madison, WI). The insert was sequenced to
ensure no mutations were introduced during the cloning process.
Overexpression of the recombinant protein from this vector was
performed in E. coli BL2 with
isopropylthio-
-galactoside induction using standard protocols
(Studier et al., 1990
). E. coli cell pellets were
routinely frozen in liquid nitrogen and stored at
80°C for up to a
month without any apparent loss in yield.
Purification of Recombinant Arabidopsis
-UP
E. coli BL21 cells containing recombinant
-UP
were pelleted by centrifugation and resuspended in one volume of
extraction buffer containing 100 mM Tris-HCl, pH 7.3, 20 mM DTT, 1 mM EDTA, 10 mM
MgCl2, 1 mM KCl, and 10 µM
leupeptin. The cells were then ruptured in a French press under a
pressure of 20,000 psi. (Initial attempts at extracting
-UP using
lysozyme to lyse the E. coli cells produced relatively
low yields of
-UP.) DNase was added to the cell extract to a final
concentration of 0.02 mg/mL and was incubated at room temperature for 5 min. The extract was centrifuged to remove cell debris and protamine
sulfate (88 µL of a 5% [w/v] solution) was added to each
milliliter of the supernatant while stirring at 4°C. The precipitate
was removed by centrifugation and the supernatant was brought to 60%
saturation with saturated ammonium sulfate (pH 7.0), and then stirred
for 20 min at 4°C. The precipitated material was collected by
centrifugation and the pellet was dissolved in 20 mM
Tris-HCl, pH 7.3, containing 20 mM DTT, and was then
dialyzed for 16 h against the same buffer using 100-kD cut-off
dialysis tubing. The dialyzed sample was applied to a Mono Q 16/10
column (Pharmacia) equilibrated with 20 mM Tris-HCl, pH
7.3, 20 mM DTT, and 5% (v/v) glycerol (buffer C). The
protein was eluted at 3 mL/min with a 0% to 30% gradient of 1 M KCl in buffer C over 50 min. Fractions containing
-UP activity were pooled and concentrated using Centriprep-50 centrifugal concentrators (Amicon). The concentrated sample was exchanged into 20 mM malonate buffer, pH 5.6, containing 20 mM
DTT and 5% (v/v) glycerol (buffer D) using a Fast Desalt column
(Pharmacia) at 1 mL/min and applied to a Mono S 5/5 column (Pharmacia)
equilibrated with buffer D. The protein was eluted at 0.5 mL/min with a
0% to 30% gradient of 1 M KCl in buffer D over 30 min.
The fractions containing
-UP activity were pooled, concentrated, and
applied to two Superose 6 columns (Pharmacia) connected in series that were equilibrated with buffer C at a flow rate of 0.3 mL/min. Active
fractions were pooled, concentrated, and stored at
70°C.
Protein Analysis
SDS-PAGE was performed using 10% to 20% (w/v) Tris-Gly gradient gels and Mark 12 molecular mass standards from Novex (San Diego). Native gel electrophoresis was performed using 4% to 20% (w/v) SDS-Tris-Gly gradient gels and Pharmacia HMW electrophoresis calibration standards. Isoelectric focusing was performed using Novex pH 3-7 gels. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis was performed by L. Alward and tryptic digestion was performed by V. Patterson of the Dow AgroSciences Biotechnology Group.
| |
ACKNOWLEDGMENT |
|---|
We thank Dr. David McCaskill of Dow AgroSciences for helpful comments.
| |
FOOTNOTES |
|---|
Received September 15, 2000; returned for revision October 16, 2000; accepted November 6, 2000.
* Corresponding author; e-mail tawalsh{at}dowagro.com; fax 317-337-3265.
| |
LITERATURE CITED |
|---|
|
|
|---|
-alanine. J
Chem Soc Chem Commun 576-578
-alanine synthase from rat liver.
J Biol Chem
268: 5686-5693
-Alanine synthase: purification and allosteric properties.
Arch Biochem Biophys
293: 254-263
[CrossRef][Medline]
-alanine amidohydrolase, the terminal enzyme in pyrimidine catabolism, by ligand-induced change in polymerization.
J Biol Chem
262: 7232-7237
-Ureidopropionase with N-carbamoyl-
-L-amino acid amidohydrolase activity from an aerobic bacterium, Pseudomonas putida IFO 12996.
Eur J Biochem
223: 625-630
[Medline]
-alanine betaine synthesis in the Plumbaginaceae: S-adenosyl-L-methionine dependent N-methylation of
-alanine to its betaine is via N-methyl and N,N-dimethyl
-alanines.
Physiol Plant
109: 225-231
[CrossRef]
-ureidopropionase from the rat liver.
Eur J Biochem
169: 21-26
[Medline]
-alanine: enzymes and cDNAs.
Prog Nucleic Acid Res Mol Biol
53: 1-78
[Medline]
-ureidopropionase.
Biochim Biophys Acta
1447: 251-257
[Medline]
-ureidopropionase of Euglena gracilis.
Biochim Biophys Acta
570: 341-351
[Medline]
This article has been cited by other articles:
![]() |
C. D. Broeckling, D. V. Huhman, M. A. Farag, J. T. Smith, G. D. May, P. Mendes, R. A. Dixon, and L. W. Sumner Metabolic profiling of Medicago truncatula cell cultures reveals the effects of biotic and abiotic elicitors on metabolism J. Exp. Bot., January 1, 2005; 56(410): 323 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |