Department of Botany (J.K., R.H.B., S.L.B., E.S.W., D.J.O.) and
Department of Biochemistry, Biophysics, and Molecular Biology (B.J.N.),
Iowa State University, Ames, Iowa 50011
Acetyl-coenzyme A (acetyl-CoA) formed within the plastid is the
precursor for the biosynthesis of fatty acids and, through them, a
range of important biomolecules. The source of acetyl-CoA in the
plastid is not known, but two enzymes are thought to be involved:
acetyl-CoA synthetase and plastidic pyruvate dehydrogenase. To
determine the importance of these two enzymes in synthesizing acetyl-CoA during lipid accumulation in developing Arabidopsis seeds,
we isolated cDNA clones for acetyl-CoA synthetase and for the ptE1
-
and ptE1
-subunits of plastidic pyruvate dehydrogenase. To our
knowledge, this is the first reported acetyl-CoA synthetase sequence
from a plant source. The Arabidopsis acetyl-CoA synthetase preprotein
has a calculated mass of 76,678 D, an apparent plastid targeting
sequence, and the mature protein is a monomer of 70 to 72 kD. During
silique development, the spatial and temporal patterns of the ptE1
mRNA level are very similar to those of the mRNAs for the plastidic
heteromeric acetyl-CoA carboxylase subunits. The pattern of ptE1
mRNA accumulation strongly correlates with the formation of lipid
within the developing embryo. In contrast, the level of mRNA for
acetyl-CoA synthetase does not correlate in time and space with lipid
accumulation. The highest level of accumulation of the mRNA for
acetyl-CoA synthetase during silique development is within the
funiculus. These mRNA data suggest a predominant role for plastidic
pyruvate dehydrogenase in acetyl-CoA formation during lipid synthesis
in seeds.
 |
INTRODUCTION |
Acetyl-coenzyme A (acetyl-CoA) is
a central metabolite in a variety of
important physiological processes that link anabolism and catabolism.
Acetyl-CoA is a substrate for the TCA cycle and is a precursor for the
biosynthesis of fatty acids, waxes, flavonoids, certain amino acids,
and isoprenoids formed via HMG-CoA and mevalonate. In addition,
acetyl-CoA is the product of the catabolism of fatty acids and some
amino acids (e.g. Leu, iso-Leu, and Trp). Despite the
importance of these metabolic processes, our understanding of
acetyl-CoA generation in plants is rudimentary (Ohlrogge and Browse,
1995
). Because acetyl-CoA-requiring metabolism occurs in different
subcellular compartments, and because membranes are impermeable to
acetyl-CoA, this molecule must either be synthesized within
each subcellular compartment where it is required or imported using
specific transporters. The question of how acetyl-CoA is generated in
plastids is of particular importance in understanding fatty acid
biosynthesis, because this process occurs predominantly in this
organelle. Considerable evidence indicates the involvement of two
enzymes in plastidic acetyl-CoA synthesis, acetyl-CoA synthetase, and
plastidic pyruvate dehydrogenase. Two other enzymes, ATP-citrate lyase
and acetylcarnitine transferase, have also been implicated, but their
contribution to acetyl-CoA formation in plastids is not universally accepted.
Over the last 40 years, several mechanisms have been postulated for the
physiological source of acetyl-CoA in plastids. Since Smirnov
(1960)
first made the observation that isolated chloroplasts can
synthesize fatty acids from exogenous acetate, acetyl-CoA synthetase
(ACS) has been implicated as the source of plastidic acetyl-CoA.
A number of studies with isolated chloroplasts have shown that
acetate is the preferred substrate for fatty acid biosynthesis (Roughan
et al., 1976
, 1979
; Roughan, 1978
; Schulze-Siebert and Schultz, 1987
;
Springer and Heise, 1989
; Heintze et al., 1990
). To explain the
possible physiological source of the acetate required by ACS, Stumpf
and co-workers (Kuhn et al., 1981
; Liedvogel and Stumpf, 1982
)
suggested that acetate may be generated by a mitochondrial acetyl-CoA
hydrolase. They envisioned that this enzyme would hydrolyze mitochondrial acetyl-CoA, and the released acetate could then readily
diffuse across membranes and be converted to acetyl-CoA in plastids by
ACS. This hypothesis was challenged due to the difficulties in
measuring acetyl-CoA hydrolase activity in mitochondria (Givan and
Hodgson, 1983
). More recently, however, Zeiher and Randall (1990)
have
partially purified and characterized this enzyme from pea mitochondria.
Alternative sources of acetate have been suggested. These include the
combined actions of pyruvate decarboxylase and acetaldehyde
dehydrogenase (Cui et al., 1996
; op den Camp and Kuhlemeier, 1997
;
Tadege and Kuhlemeier, 1997
) or the action of O-acetyl-Ser
thiol-lyase in forming Cys from O-acetyl-Ser (Leustek and
Saito, 1999
).
The identification of a plastidic pyruvate dehydrogenase complex (PDC)
(Reid et al., 1977
; Elias and Givan, 1979
; Williams and Randall, 1979
;
Camp and Randall, 1985
; Camp et al., 1988
; Randall et al., 1989
) led to
the concept that plastids may be autonomous in their ability to
generate acetyl-CoA from pyruvate (Denyer and Smith, 1988
; Randall et
al., 1989
; Hoppe et al., 1993
).
In chloroplasts, pyruvate may be generated from photosynthesis
(Denyer and Smith, 1988
; Randall et al., 1989
; Hoppe et al., 1993
),
whereas in non-photosynthetic plastids (e.g. leucoplasts of castor bean
endosperm) malate and glycolytic metabolism may give rise to pyruvate
(Smith et al., 1992
). The concept that plastidic acetyl-CoA may be
derived from pyruvate has received additional acceptance with the
isolation of cDNA clones coding for subunits of plastidic PDC (Johnston
et al., 1997
).
ATP-citrate lyase, which generates acetyl-CoA in animal cells, has been
suggested as the source of acetyl-CoA in plants (Nelson and Rinne,
1975
, 1977a
, 1977b
).
However, studies to ascertain the subcellular location of this
enzyme in plants are inconclusive; Fritsch and Beevers (1979)
and
Ratledge et al. (1997)
reported ATP-citrate lyase as plastidic, whereas
Kaethner and ap Rees (1985)
concluded that ATP-citrate lyase is
cytosolic. Therefore, a role for ATP-citrate lyase in generating
plastidic acetyl-CoA is unclear.
Last, it has been suggested that acetylcarnitine may be a source of
plastidic acetyl-CoA (Masterson et al., 1990a
, 1990b
; Thomas et al.,
1993
); however, this mechanism has been challenged (Roughan et al.,
1993
). Thus, only two enzymes, ACS and plastidic PDC, are known to
generate plastidic acetyl-CoA.
The purpose of this study was to determine the contribution of ACS and
plastidic PDC to the production of acetyl-CoA in plastids, primarily
during seed development in Arabidopsis. To address this question, we
isolated Arabidopsis cDNA clones coding for ACS and the ptE1
- and
ptE1
-subunits of plastidic PDC. We compared the spatial and temporal
patterns of ACS and ptE1
mRNA accumulation with the pattern of lipid
accumulation and plastidic acetyl-CoA carboxylase expression (Ke et
al., 2000
) during seed development. These data indicate that pyruvate
is the main precursor of acetyl-CoA in plastids of developing
Arabidopsis seeds.
 |
RESULTS |
Cloning of ACS Genic Sequences
ACS has been studied from a variety of organisms and DNA sequences
are available for microbial, fungal, and animal ACS genes. These
sequences were used to search the Arabidopsis EST database, which
resulted in the identification of a single cDNA clone (accession no.
N38599) that shared substantial sequence similarity with the known ACS sequences. This cDNA was obtained from the Arabidopsis Biological Research Center (Ohio State University, Columbus) and sequenced. Sequence analysis showed that this clone was only a partial
cDNA and a series of 5' cRACE experiments and PCR-based library screens
were used to obtain the sequence of the nearly full-length Arabidopsis
ACS cDNA (submitted to GenBank as accession no. AF036618).
The protein deduced from this cDNA clone is composed of 693 amino acid
residues with a calculated molecular mass of 76,678 D (Fig.
1). The N terminus of the protein has
some characteristics of a plastid targeting sequence (von Heinje et
al., 1989
; von Heinje and Nishikawa, 1991
) and computer analysis
(PSORT-Sequence Interpretation Tools, GenomeNet, Kyoto, Japan)
yielded equivocal results for subcellular targeting. Based on the
alignment with the other ACS sequences (Fig. 1), the mature Arabidopsis
ACS has an estimated molecular mass of 70 to 72 kD. The value is only approximate because of the lack of sequence identity before the region
of high similarity that begins with the Val at residue 54. The sequence
identity shared among the Arabidopsis, yeast (44% and 43% identical
to yeast ACS1 and ACS2, respectively), and Escherichia coli
(50% identical) ACS proteins is distributed along the length of the
protein (Fig. 1). One of the most conserved regions is between amino
acid residues 308 and 319 (Fig. 1); this sequence is the AMP-binding
domain. Enzymes that contain this domain form covalent intermediates
between their substrate (acetate in the case of ACS) and AMP (Webster,
1965
; Toh, 1991
).

View larger version (95K):
[in this window]
[in a new window]
|
Figure 1.
Multiple sequence alignments for ACS proteins from
Arabidopsis, yeast, and E. coli. The Arabidopsis ACS protein
was aligned with the ACS1 and ACS2 proteins from yeast and the ACS
protein from E. coli using the CLUSTAL W program (Thompson
et al., 1994 ). The alignment was visualized using BOXSHADE (Kay Hoffman
and Michael D. Baron; http://ulrec.3.unil.ch\software\BOX_form.html).
White letters in a black field represent identical amino acids in two
or more sequences. White letters in a gray field indicate conserved
substitutions.
|
|
A portion of the putative Arabidopsis ACS protein was expressed
in E. coli, and this protein was used to raise a polyclonal antiserum in rabbits. This antiserum was used to support the
identification of the ACS cDNA clone. While incubation with preimmune
serum had no effect on ACS activity in Arabidopsis leaf extracts,
incubation with the antiserum to the putative ACS protein strongly
inhibited ACS activity (Fig. 2).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 2.
Immunoprecipitation of ACS activity by an
antiserum against the transgenic putative ACS protein expressed in
E. coli. Arabidopsis leaf extract was incubated for 60 min
with the indicated concentration of preimmune or antiserum raised
against the recombinant protein followed by a 60-min incubation with
protein A agarose followed by centrifugation. The remaining ACS
activity in the supernatant was then measured.
|
|
SDS-PAGE and immunoblot analysis of Arabidopsis leaf extracts showed
that the ACS antiserum recognizes a single polypeptide with an apparent
molecular mass of about 70 kD. This agrees closely with the 70 to 72 kD
predicted for the mature form of the protein. Figure
3 shows the results of gel filtration
analysis of an Arabidopsis extract. The fractions were analyzed for ACS
activity and for the presence of the ACS polypeptide. ACS activity and
the immunologically identified ACS polypeptide eluted as a single
symmetric peak with an apparent molecular mass of approximately 70 kD.
These data, together with those from the immunoprecipitation
experiment, provide strong correlative support that the ACS enzyme
activity is encoded by the putative ACS cDNA clone described in this
study. The Arabidopsis ACS protein, therefore, appears to be
monomeric.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3.
Gel filtration analysis of ACS from Arabidopsis.
The 30% to 55% ammonium sulfate precipitate from an
Arabidopsis leaf extract was resolved by gel filtration chromatography
on a Superdex 220 HR 10-30 column equilibrated in buffer B. The
numbers at the top of the figure are molecular mass standards for
chromatography. The fractions were analyzed for ACS activity and for
the presence of immunoreactive ACS protein. The immunoreactive bands
shown at the bottom of the figure contain protein from two column
fractions and are aligned with the corresponding fractions.
|
|
ACS Activity Is Localized in the Plastids
Protein extracts from purified Arabidopsis chloroplasts showed
both ACS enzyme activity and the 70-kD band upon western blotting. To
provide a quantitative estimate of the amount of ACS activity localized
in the plastid, the activities of ACS and NADP+
G3PDH (a chloroplastic marker enzyme [Quail, 1979
]) were determined in Arabidopsis protoplasts and in purified chloroplasts isolated from
them. In eight experiments, G3PDH activities in the protoplasts and
chloroplasts were 0.349 ± 0.023 unit and 0.241 ± 0.023 unit, respectively, whereas ACS activities were 2.699 ± 0.226 units in the protoplast and 1.819 ± 0.108 units in the
chloroplasts. A comparison of these data revealed that 97.7% ± 5.5%
of the ACS activity was localized in the chloroplasts.
Southern-blot analysis of Arabidopsis DNA probed with the ACS cDNA
indicated that there is a single ACS gene in Arabidopsis under
high-stringency hybridization and wash conditions (Fig. 4). No additional specific bands appeared
when the stringency of the hybridization and wash were decreased to
45°C and 0.2× SSC (not shown). The genomic clone for ACS has
recently been localized on chromosome 5 (accession no. AB025605).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 4.
Southern-blot analysis of Arabidopsis DNA
probed with the cDNA for ACS. Approximate molecular masses (in kb) are
indicated.
|
|
Cloning and Sequencing of the E1
- and E1
-Subunits of
Plastidic PDC
Searching the Arabidopsis EST database with the sequences of the
ptE1
and ptE1
PDC subunits from chloroplasts of the algae Porphyra purpurea identified Arabidopsis EST clones for
ptE1
and ptE1
. Both of the Arabidopsis plastidic E1
PDC
sequences were 68% identical to the plastidic PDC from the red algae
and only 37% identical to the mitochondrial PDC from Arabidopsis. The
Arabidopsis ptE1
sequence was 50% and 34% identical to the sequences from P. purpurea and the Arabidopsis mitochondrial
PDC, respectively. Johnston et al. (1997)
recently published a detailed characterization of the cDNA clones for the E1
- and E1
-subunits of plastidic PDC. Under the stringency used, the mitochondrial clones
did not hybridize with the plastid clones.
The cDNAs for the ptE1
- and ptE1
-subunits were cloned into
pET24-a and simultaneously expressed in E. coli. Although
the construct was designed to express both PDH subunits simultaneously, only the ptPDH
-subunit accumulated to detectable levels and was present in the insoluble fraction of the E. coli lysate.
This insoluble fraction was used to produce antibodies in rabbits.
SDS-PAGE and western analysis of Arabidopsis extracts with anti-ptE1
serum identified a protein of approximately 40 kD. This is the size of
the E1
-subunit of plastidic PDC. No polypeptides of 36 kD (the size
of the ptE1
-subunit) were detected. Mitochondria and chloroplasts
were isolated from pea shoots and purified on Percoll gradients. When
soluble proteins from these two organelles were analyzed by SDS-PAGE
and western blotting, the anti-ptE1 serum recognized the E1
-subunit
of plastidic PDC and mitochondrial PDC with equal
sensitivity (data not shown). It was not possible, therefore, to use
this antiserum to differentiate between the PDC from the different
organelles in whole-cell extracts. When stromal extracts from pea
chloroplasts were resolved by gel filtration chromatography and
analyzed by western blotting, the ptE1
fractionated with an apparent
molecular mass of 150 kD, possibly representing an
2
2 heterotetramer
(data not shown).
ACS and ptE1
mRNA Accumulation during Silique Formation
RNA was isolated from leaves, flower buds, and flowers, as well as
developing siliques 1 to 15 d after flowering (DAF). The accumulation of the ACS and ptE1
mRNAs was determined by
quantitative northern-blot analysis (Fig.
5). In siliques at 1 DAF, ACS mRNA accumulated to a level comparable to that found in leaves, flower buds,
and open flowers (Fig. 5). However, as the siliques developed, the
accumulation of the ACS mRNA declined, so that by 4 DAF it was at 40%
of the peak level and by 15 DAF it was less than 20% of the peak
level.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5.
Accumulation of the mRNAs for ACS and ptE1 in
leaves, buds, flowers, and developing siliques (at the indicated DAF)
determined by quantitative northern-blot analysis. The data presented
are typical of the results from four independent experiments. White
bars, Pyruvate dehydrogenase; black bars, ACS.
|
|
The accumulation pattern of the ptE1
mRNA showed a much more dynamic
response during silique development (Fig. 5). This mRNA accumulated to
levels between 2- and 10-fold higher than the ACS mRNA. At the initial
stages of silique development (1 DAF), the ptE1
mRNA accumulated to
levels similar to those found in flowers. Subsequently, as the silique
expanded, the amount of ptE1
mRNA reproducibly decreased to about
70% of the initial level by 3 DAF. This was followed by a 3-d period
when the ptE1
mRNA levels increased by about 2-fold, reaching a peak
between 6 and 7 DAF. After this peak, the amount of ptE1
mRNA
decreased to reach about 15% to 20% of peak levels by 11 DAF.
In Situ Hybridization
To obtain a more comprehensive understanding of the patterns of
ACS and pPDH expression during silique development, we examined the
cellular distribution of ACS and ptE1
mRNA accumulation by in situ
hybridization. This is significant because each of the different cell
types within a silique are likely to have different metabolic demands
for plastidic acetyl-CoA. For example, whereas fatty acid biosynthesis
is likely to be most active in all growing tissues to satisfy demands
for the deposition of membrane lipids required for growth, the
developing embryo also synthesizes fatty acids that are deposited in
specialized organelles (oleosomes) as triacylglycerol.
Siliques of different ages (1-15 DAF) were collected, sectioned, and
probed as described in "Materials and Methods" with radioactively labeled sense and antisense ACS and ptE1
RNAs (Fig.
6). Figure 6 also shows,
for comparison, hybridizations carried out with the
carboxyl-transferase-
-subunit of plastidic ACCase (Choi et al.,
1995
). The plastidic ACCase is composed of four separate subunits, and their spatial accumulation patterns during silique development are indistinguishable from each other (Ke et al., 2000
).


View larger version (295K):
[in this window]
[in a new window]
|
Figure 6.
Cellular localization of the mRNA encoding ACS and
ptE1 during development of Arabidopsis siliques and seeds. Tissue
sections were hybridized with antisense RNA probes to detect acetyl-CoA
synthetase mRNA (12-d exposures) (A, D, G, J, M, P, and T-X) and the
ptE1 mRNA (4-d exposures) (B, E, H, K, N, and Q). The accumulation
of the mRNA coding for the carboxyl-transferase- -subunit of
plastidic ACCase (4-d exposures) is shown for comparison (Ke et al.,
2000 ) (C, F, I, L, O, and R). A single, typical control is shown in
which sense ptE1 RNA is used as a probe (S). The control was
processed exactly like the experimental sample. A to C, Siliques 1 DAF;
D to F and T, siliques 3 DAF; G to I, siliques 5 DAF; J, K, L,and S, siliques 7 DAF; M to O, siliques 9 DAF; and P to
R, siliques 12 DAF. Seeds at 1 (U), 2 (V), 3 (W), and 4 (X) d after
imbibition probed for ACS mRNA. Tissue sections are stained with
toluidine blue O. sc, Seed coat; rt, root; cot, cotyledon; w, silique
wall; ii, inner integument of ovule; oi, outer integument of ovule; o,
ovule; ge, globular embryo; he, heart embryo; te, torpedo embryo; ce,
curled embryo; me, mature embryo; s, central septum; fu, funiculus.
Bar = 55 µm in A through U;130 µm in V; 250 µm in W; 300 µm in X.
|
|
At 1 DAF, the ACS mRNA was present throughout the developing silique,
but was enriched in the funiculus and ovule (Fig. 6A). By 2 to 3 DAF,
the ACS mRNA accumulated predominantly in the funiculus and ovule (Fig.
6, D and T) and its accumulation in the silique wall had declined. In
3-DAF siliques, maximum ACS mRNA accumulation occurred in the globular
embryo (Fig. 6D). The accumulation of the ACS mRNA decreased in older
siliques (except within the funiculus), so that it was barely
detectable in 5-DAF siliques and undetectable in 7-DAF or older
siliques (Fig. 6, G, J, M, and P). The accumulation of the ACS mRNA in
the funiculus persisted in siliques up to 12 DAF (data not shown). When
seeds were imbibed, there was a large induction in the accumulation of
the ACS mRNA in the tip of the radicle of seeds by 1 d after
imbibition, and this accumulation continued in the root tip for at
least the first 4 d after imbibition (Fig. 6, U-X).
The spatial accumulation pattern of the ptE1
mRNA was nearly
identical to that of the plastidic ACCase subunit mRNAs
(Fig. 6; Ke et al., 2000
) and was distinct from that of the
ACS mRNA. At 1 to 2 DAF, the mRNAs coding for the ptE1
-subunit
and the carboxyl-transferase-
-subunit of plastidic ACCase were
evenly distributed throughout the developing silique (Fig. 6, B and C). By 3 DAF, both mRNAs were concentrated within the globular embryo (Fig.
6, E and F), although the plastidic ACCase signal was much greater than that for ptE1
. Subsequently, the accumulation of these
two mRNAs increased substantially in the developing embryos of 5-DAF
siliques and peaks in embryos of 7-DAF siliques (Fig. 6, H, I, K, and
L). Starting from siliques at 7 DAF, the accumulation of the ptE1
and carboxyl-transferase-
mRNA decreased until the seed matured at
about 12 DAF (Fig. 6, K, L, N, O, Q, and R). In 15-DAF siliques, both
mRNA species were undetectable (data not shown).
 |
DISCUSSION |
Plants have the capacity to synthesize a diverse set of
compounds from acetyl-CoA. Many of these acetyl-CoA-requiring
biosynthetic pathways are compartmentalized at the subcellular level,
occurring in plastids, mitochondria, or in the cytosol (Liedvogel
and Bauerle, 1986
). Furthermore, in vivo labeling studies indicate that
the source of acetyl-CoA for biosynthetic processes may vary between cell types, between different developmental stages of one tissue, and
between different species for the same tissue (Denyer and Smith, 1988
;
Smith et al., 1992
; McCaskill and Croteau, 1995
; Eastmond and
Rawsthorne, 1997
). Therefore, plants appear to have multiple mechanisms
for generating acetyl-CoA that are both spatially and temporally
separated. Such multiplicity in acetyl-CoA-generating mechanisms would
enable plants to differentially regulate the supply of this precursor
for the biosynthesis of different phytochemicals.
Characterization of Arabidopsis Acetyl-CoA Synthetase
This report contains the first (to our knowledge) identification
of the genic sequence of a putative plant ACS. With the ever-increasing availability of cDNA and genomic DNA sequences in publicly accessible databases, searching for a given protein sequence by homology-based methods has become common. However, corroborating evidence is necessary
to establish whether the deduced amino acid sequence obtained by
homology searches is indeed the protein of interest. Strong support of
this identification was provided by antiserum raised against the
recombinant putative Arabidopsis ACS protein, which specifically
inhibited ACS enzymatic activity, co-fractionation of the protein
identified by the antiserum and ACS activity by gel filtration
chromatography, and co-localization of both the protein and the ACS
activity to the plastid.
Computational analyses (GeneRunner, Hastings Software, Hastings on
Hudson, NY; and MACAW [Schuler et al., 1991
]) of the ACS cDNA
sequence predicted a molecular mass of about 77 kD for the ACS
preprotein and about 70 to 72 kD for the mature ACS protein (after
removal of the putative plastid-targeting leader). While computer
analysis was inconclusive on the presence of a plastid targeting
sequence, immunoblot analyses with purified chloroplasts showed
that the protein was present in this organelle. The quantitative demonstration that most if not all of the ACS activity resides in the
chloroplasts (97.7% ± 5.5%) argues strongly for an exclusive plastidic localization of ACS. To date, searches of the Arabidopsis sequence and low-stringency Southern blotting have provided no evidence
for a second ACS gene encoding a cytosolic isoform of the enzyme. The
plastidic localization does not explain data from other oilseed crops
showing incorporation of labeled acetate into long-chain fatty acids
during cytosolic elongation (Ohlrogge et al., 1978
; Bao et al., 1998
).
Plastidic acetyl CoA might be transported to the cytosol by a
carnitine-based transport system (Masterson et al., 1990a
, 1990b
;
Thomas et al., 1993
), although this is not universally accepted
(Roughan et al., 1993
). Additional metabolic studies on cytosolic
acetate metabolism are clearly needed.
Gel filtration chromatography of an ACS preparation established that
ACS enzyme activity and immunoreactive ACS protein co-eluted with an
approximate molecular mass of 70 kD, which is the same as that of the
subunit as determined by SDS-PAGE. These data indicate that the
Arabidopsis ACS is monomeric, as is the enzyme from mammalian sources
(Londesborough et al., 1973
; Imesch and Rous, 1984
) and pea (R.H.
Behal, unpublished results). In contrast, the ACS from yeast (Frenkel
and Kitchens, 1977
) and bacteria, including Bradyrhizobium japonicum (Preston et al., 1990
) and Methanothrix
soehngenii (Jetten et al., 1989
), are homodimers.
Role of Plastidic PDC in Lipid Synthesis in Developing
Seeds
There is limited biochemical evidence as to the relative
contribution of ACS and plastidic PDC in acetyl-CoA synthesis in seed
plastids. This is in part due to the difficulty associated with the
isolation of high-quality plastids from developing embryos and
endosperm, together with the difficulty in distinguishing plastidic PDC
from mitochondrial PDC activities and plastidic PDC from mitochondrial
PDC subunits. Several studies (Miernyk and Dennis, 1983
; Liedvogel and
Bauerle, 1986
; Smith et al., 1992
; Kang and Rawsthorne, 1994
, 1996
)
have isolated plastids from oilseed endosperm, embryos, or cotyledons.
In each case, 14C-pyruvate was a superior
substrate to 14C-acetate for the formation of
fatty acids. These results were clearly different from results obtained
with chloroplasts isolated from spinach and barley leaves (Roughan et
al., 1976
; Murphy and Leech, 1977
; Roughan, 1978
; Schulze-Siebert and
Shultz, 1987
; Springer and Heise, 1989
; Heintze et al., 1990
). These
latter studies found that higher rates of lipid biosynthesis could be obtained with exogenously supplied 14C-acetate
than 14C-pyruvate. Thus, the biochemical evidence
is consistent with plastidic PDC being the major source of acetyl-CoA
for lipid synthesis in plastids of embryos.
During silique development, the temporal and spatial accumulation
patterns of the ptE1
mRNA are consistent with a role for plastidic
PDC in fatty acid biosynthesis. While this conclusion is based on mRNA
levels, and it is possible that translational and/or post-translational
controls would obscure a connection between mRNA levels and in vivo
enzyme activities, the conclusion is supported by comparing the
accumulation pattern of ptE1
mRNA with that of the mRNAs coding for
subunits of one of the key enzymes of fatty acid biosynthesis,
plastidic ACCase (Ke et al., 2000
). Specifically, during the initial
stages of the development of the silique (1 DAF), these mRNAs were
evenly distributed among all tissues of this organ. Later, as the
silique ceased to elongate, and the embryos within developed through
the late-heart and torpedo stages (5-7 DAF), accumulation of these
mRNAs reached maximum accumulation within the embryos, but declined in
the non-embryo tissues. This pattern of mRNA accumulation is correlated
with the expected pattern of fatty acid biosynthesis (Bowman, 1994
): At
the early stages of the development of the silique, when it is
expanding, there should be a relatively high demand for fatty acids
among all the cells of this organ, which would be used for the
deposition of membranes to support its growth. Later, when growth of
the non-embryo tissues of the silique ceases, the embryo itself grows,
and within it large quantities of fatty acids are deposited as
triacylglycerol molecules.
Role of ACS
In contrast to the accumulation pattern of ptE1
mRNA, ACS mRNA
accumulated with a spatial and temporal pattern that is distinct from
that of the plastidic ACCase subunit mRNAs and from the expected pattern of fatty acid accumulation. During silique development, the ACS
mRNA accumulated to low levels in the embryos of Arabidopsis at times
when both plastidic ACCase mRNA accumulation and fatty acid
accumulation are at a maximum. Given the caveats about predicting in
vivo enzyme activities from mRNA levels, these results indicate that
acetyl-CoA synthetase may not be important in providing acetyl-CoA for
fatty acid synthesis for oils. Interestingly, within the silique, maximal accumulation of ACS mRNA occurred in the funiculus.
Furthermore, within the organs examined, maximal accumulation of ACS
mRNA occurred in root tips of radicles of embryos in germinating seeds
from 1 to 4 d after imbibition. We surmise that ACS may have a
more specialized role in generating plastidic acetyl-CoA in those cells that maximally accumulate this mRNA.
 |
MATERIALS AND METHODS |
Cloning of ACS and PDC ptE1
and ptE1
cDNAs from
Arabidopsis
The Arabidopsis EST database was searched using sequences for
ACS from yeast and Escherichia coli. One Arabidopsis
sequence (accession no. N38599) was identified that was similar to the known ACS sequences. This clone was obtained from the Arabidopsis Biological Research Center and sequenced. It appeared to encode about
40% of ACS, corresponding to the C-terminal ends of the known ACS
proteins. A series of cRACE (Maruyama et al., 1995
) experiments using
mRNA isolated from Arabidopsis tissue and PCR amplification of an
Arabidopsis cDNA library (Wang and Oliver, 1996
) allowed us to
determine the rest of the cDNA sequence. Once the entire ACS cDNA
sequence was determined, an intact clone was amplified from the cDNA
library using PCR primers matching the sequences of the 3' and 5' UTRs.
This sequence was submitted to GenBank (accession no. AF036618).
cDNA clones coding for the ptE1
- and ptE1
-subunits of the
plastidic PDC were identified in a similar manner. In these instances the sequences from the ptE1
- and ptE1
-subunits of plastidic PDC
found within the chloroplast genome of the red algae Porphyra purpurea were used to search the Arabidopsis EST database.
Potential clones for ptE1
(accession nos. N65567 and N65566) and ptE1
(accession nos. R29966 and R64987) were obtained from the
Arabidopsis Biological Research Center and sequenced. cDNA clone N65567
was found to encode for all but approximately 15% of the N terminus of
the mature plastid E1
; therefore, it was designated ptE1
and used
in this study. cDNA clone R22966 (designated as ptE1
-1) contained
nearly the entire coding region of ptE1
and was also used in this
study. Since this sequencing was finished, Johnston et al. (1997)
also
identified these sequences as coding for the E1
- and E1
-subunits
of plastidic PDC and have provided the sequences for the full-length
cDNAs (U80185 and U80186). We also identified a second ptE1
cDNA
(ptE1
-2) encoding a protein that is 98% identical at the amino acid
level to the mature ptE1
-1 protein (Behal and Oliver, 1999
). The
sequence of this cDNA was submitted to GenBank as accession number
AF167983.
DNA Isolation and Southern Blotting
DNA was isolated using the PHYTOPURE plant DNA extraction kit
(Nucleon Biosciences, Coatbridge, UK). Genomic DNA was digested with
the appropriate restriction endonucleases. DNA fragments were resolved
by agarose gel electrophoresis, denatured with 0.5 M
NaOH/1.5 M NaCl, and transferred by buffer flow to genomic
blotting membrane (Zeta-Probe, Bio-Rad Laboratories, Hercules, CA). The membrane was briefly neutralized in 0.5 M Tris-HCl, 1.5 M NaCl, pH 8.0, and DNA was immobilized by UV irradiation.
The membrane was prehybridized in 7% (w/v) SDS, 1%
(w/v) casein, 1 mM EDTA, 0.25 M NaPi, pH
7.4 (Church and Gilbert, 1984
), for 1 h at 65°C. Gene-specific 32P-labeled probe(s) were denatured by
incubation at 65°C in the presence of 0.1 M NaOH for 10 min, and were added directly to the prehybridization buffer. The probes
were allowed to hybridize to their target sequences overnight at
65°C. Non-specific binding was removed by successive 10-min washes
in: 2× SSC/0.1% SDS (w/v), 0.2% SSC/0.1% SDS (w/v),
0.1% SSC/0.1% SDS (w/v) (at room temperature), followed by
0.1% SSC/0.1% SDS (w/v) at 65°C. Hybridizing bands were visualized by exposure to BIOMAX MS film (Eastman-Kodak, Rochester, NY).
Immunological Methods
A portion of the ACS cDNA was PCR amplified from the N38599 EST
cDNA clone using primers J9NT1 (gatgaattcggaagtgttgtggtgagcccat) and
J9CT1 (atcaagctttcatcacacatcggcaagtgca), which allowed the resulting
fragment to be cloned into the E. coli expression vector pMALC-2 (New England Biolabs, Beverly, MA). This clone was transformed into E. coli, and expression of the recombinant protein
was induced with isopropylthio-
-galactoside. The resulting fusion
protein was a chimera consisting of the 264 amino acids at the C
terminus of ACS fused to the E. coli maltose binding
protein. This recombinant protein was isolated from 1-L cultures,
purified on an amylose column as per the manufacturer's methods, and
assayed for purity by SDS-PAGE. The purified recombinant protein was
isolated from the gel and used to immunize rabbits for the production
of polyclonal antibodies. The avidity of the resulting antiserum and
antibody binding conditions were optimized using a full-length ACS
transgenic protein produced from the pET24-a E. coli
expression vector.
The antisera against the ptE1 subunits were prepared in a
similar manner. The cDNA clones for both ptE1
and ptE1
were
cloned separately into pET24-a vectors. The ptE1
expression cassette containing the T7-promoter, ptE1
coding region, and the vector transcriptional terminator was then excised from the
ptE1
clone and incorporated into the ptE1
pET24-a expression
vector. This created a plasmid capable of simultaneously expressing
both ptE1
- and ptE1
-subunits in E. coli. The
expressed subunit(s) accumulated as insoluble inclusion bodies that
were isolated and purified by SDS-PAGE. Since it was not possible to
separate the two recombinant subunits by SDS-PAGE, this protein mixture
was used to immunize rabbits.
Protein samples from column fractions, isolated organelles, and whole
leaves were resolved by SDS-PAGE in 15% (w/v) acrylamide gels
using a mini gel apparatus (Idea Scientific, Minneapolis). For western
blotting, proteins were electrophoretically transferred to
nitrocellulose in 10 mM 3-(cyclohexylamino)propanesulfonic acid (CAPS), 10% (w/v) methanol, pH 10.5, using a blotting
apparatus (Genie, Idea Scientific). Immunodetection of specific
proteins was performed following standard protocols (Bolag and
Edelstein, 1991
).
Characterization of ACS
ACS activity was assayed essentially according to the method of
Roughan and Ohlrogge (1994)
with some changes. Aliquots (1-10 µL) of
protein were diluted into buffer A (25 mM Tris-HCl and 50 mM KCl, pH 8.5) to a final volume of 90 µL. Ten
microliters of 10× assay mix (2.5 mM CoASH, 25 mM potassium [1-14C]acetate [3.2 × 106 cpm/µmol], 25 mM ATP, 50 mM
MgCl2, and 10 mM dithiothreitol [DTT]) was
added to each reaction tube. After incubation for 5 min at room
temperature, 75 µL of the reaction mix was spotted onto a 2.5-cm
DE-81 filter circle, which was washed three times for 5 min each in 2%
(v/v) acetic acid, rinsed in acetone, dried, and subjected to
liquid scintillation counting in the presence of 5 mL of scintillation
fluid (Ready Safe, Beckman Instruments, Fullerton, CA).
A crude ACS preparation was made from extracts of mature Arabidopsis
leaves. Plants were harvested, washed with cold water, and cooled to
4°C. The tissue was suspended in a minimal volume of buffer A
supplemented with 10 mM
-mercaptoethanol, 1 mM benzamidine, 0.1 mM phenylmethylsulfonyl
fluoride (PMSF), 0.1% (w/v) defatted bovine serum albumin
(BSA), 1 mM EDTA, and 1% (w/v)
polyvinylpolypyrrolidone, and homogenized in a cold Waring blender with
several 5-s high-speed bursts. Following filtration through two layers
of cheesecloth and two layers of Miracloth (Calbiochem-Novabiochem, La
Jolla, CA), the extract was clarified by centrifugation at
25,000g at 4°C for 15 min. The supernatant was
subjected to ammonium sulfate precipitation, and ACS activity was
recovered in the fraction that precipitated between 30% and
55% saturated ammonium sulfate; ACS activity was stable in this
30% to 55% pellet for several months at
20°C.
A sample of the 30% to 55% ammonium sulfate precipitate was
resuspended in a minimal volume of buffer B (25 mM Tris-HCl
and 150 mM KCl, pH 8.5) and clarified by centrifugation. A
250-µL aliquot was applied to a Superdex 220 HR 10-30 column
(Amersham-Pharmacia Biotech, Piscataway, NJ) equilibrated in buffer B. Fractions were collected and characterized by enzyme assay and western blotting.
The antiserum raised against the bacterially produced recombinant ACS
protein was used to immunoprecipitate the Arabidopsis ACS protein. A
crude Arabidopsis extract was incubated with increasing concentrations
of antiserum for 60 min. After an additional 60-min incubation with
protein-A agarose (Pierce Chemical, Rockford, IL), the extract was
centrifuged at 12,000g for 5 min, and the supernatant
was assayed for ACS activity.
Preparation of Arabidopsis Chloroplasts and Pea Organellar
Extracts
Chloroplasts were isolated from purified Arabidopsis protoplasts
as described by Kunst (1998)
. Protoplast and chloroplast extracts were
prepared by incubation with 0.1% (v/v) Triton X-100; the
resulting solutions were clarified by centrifugation
(12,000g for 10 min) and assayed for ACS and
NADP+-dependent glyceraldehyde-3-P dehydrogenase (G3PDH)
(Worthington, 1988
).
Crude pea mitochondria were prepared according to the method of Behal
and Oliver (1997)
. Mitochondria were purified by Percoll gradient
centrifugation according to the method of Douce et al. (1987)
.
Chloroplasts were prepared according to the method of Joy and Mills
(1987)
.
RNA Isolation and Northern Blotting
RNA was extracted from Arabidopsis leaves, buds, flowers, and
siliques as described previously (Weaver et al., 1995
).
Non-radioactive sense ACS and ptE1
RNA concentration standards were
made by in vitro transcription from the respective pBSK cDNA clones (Ke
et al., 2000
). The RNA concentration of the standards was determined from A280 and
A260, and by comparison with standards of
known concentration following ethidium bromide staining of gels. Ten micrograms of RNA isolated from each Arabidopsis sample, along with a
range of RNA concentration standards (0.01-10.00 pg), were fractionated by electrophoresis in formaldehyde-containing agarose gels
(Ke et al., 2000
). After transfer of the RNA to nylon membranes (Magna
Lift, MSI, Micron Separations, Westborough, MA), hybridizations were conducted in a buffer containing 50% (v/v) formamide at
65°C for 12 to 16 h using 32P-labeled probes.
32P-Labeled antisense RNA probes were transcribed from
vectors containing the ACS and ptE1
cDNA inserts. Hybridized
membranes were rinsed twice with 2× SSC, 2% (w/v) SDS for 10 min each at room temperature, and then washed twice with 0.1× SSC,
0.1% (w/v) SDS for 20 min each at 65°C. The membranes were
exposed to a phosphor screen (Molecular Dynamics, Sunnyvale, CA) for 4 to 20 h, and the radioactivity in each band was quantified with a
phosphor imager (Storm 840, Molecular Dynamics). An entire set of
samples (1- to 15-DAF siliques and plant organs) from two different
sets of embryos and plants was repeated twice with similar results; two
partial sets of samples were also duplicated with similar results. ACS
and ptE1
mRNA concentrations in each tissue sample were determined
by comparing the intensities of the mRNA bands with those of a range of
RNA concentration standards (Ke et al., 2000
).
In Situ Hybridization
Arabidopsis siliques were harvested daily between 1 and 15 DAF.
Siliques were cut into 3- to 4-mm-long pieces, fixed, and sectioned as
previously described (Ke et al., 1997
). 35S-Labeled
antisense and sense RNA probes were transcribed from vectors containing
cDNA inserts encoding ACS and ptE1
. cDNA encoding the
carboxyl-transferase
-subunit of plastidic ACCase was also used as a
probe (Ke et al., 2000
). After hybridization and washing, the tissue
sections were coated with Kodak NTB2 emulsion, exposed for 2 to 4 d, and developed. Slides were stained with toluidine blue to detect
cellular structure. Photographs were taken with a microscope (Orthopha,
Leitz, Wetzlar, Germany) using bright-field optics. In situ
hybridizations were repeated three or more times, all with similar
results. In situ hybridizations to detect ACS and ptE1
mRNAs were
conducted in parallel. Control slides containing sections of the same
siliques were hybridized with 35S-labeled sense RNA probes
simultaneously with the antisense RNA hybridizations. Virtually no
signal was detected in the control slides hybridized with sense RNA
probes. For space considerations, the data presented in Figure 6 are
from siliques isolated on selected DAF.
Received October 4, 1999; accepted February 15, 2000.