|
|
||||||||
|
Plant Physiol. (1999) 119: 481-488 Complementary DNA Cloning and Characterization of Ferredoxin Localized in Bundle-Sheath Cells of Maize Leaves1
Division of Enzymology (T.M., Y.K.-A., T.H.), and Division of Organic Chemistry (H.M., T.T., Y.S.), Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka, 565-0871 Japan; and Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka, 565-0871 JapanDepartment of Biological Mechanisms and Functions, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, 464-8601 Japan (H.S., T.S.)
In
maize (Zea mays L.) two leaf-specific ferredoxin (Fd)
isoproteins, Fd I and Fd II, are distributed differentially in
mesophyll and bundle-sheath cells. A novel cDNA encoding the precursor
of Fd II (pFD2) was isolated by heterologous hybridization using a cDNA
for Fd I (pFD1) as a probe. The assignment of the cDNAs to the Fds was
verified by capillary liquid-chromatography/electrospray ionization-mass spectrometry. RNA-blot analysis demonstrated that transcripts for Fd I and Fd II accumulated specifically in mesophyll and bundle-sheath cells, respectively. The mature regions of pFD1 and
pFD2 were expressed in Escherichia coli as functional
Fds. Fd I and Fd II had similar redox potentials of
Maize (Zea mays L.), a typical C4
plant, is characterized by the compartmentation of carbon assimilation
into two differentiated photosynthetic cells, MC and BSC. Atmospheric
CO2 is first incorporated into oxaloacetate in
the MC cytosol and is successively reduced to malate with the
consumption of NADPH in the MC chloroplasts (Hatch, 1987 Some other NAD(P)H-requiring processes are also restricted to MC in
maize leaves. The reduction of nitrate occurs exclusively in MC (Moore
and Black, 1979 On the other hand, BSC chloroplasts produce ATP required to drive the
C3 cycle by cyclic electron flow via PSI,
irrespective of the absence of PSII (Edwards and Walker, 1983 Fd, an electron-transfer protein, occupies a key position both for
transferring the photoreducing power to FNR, hence the formation of
NADPH, and for mediating the cyclic electron flow around PSI (Arnon,
1989 Fd is present as isoforms in most of the higher plants examined to
date. In maize four Fd isoproteins (Fd I to Fd IV) were found in young
seedlings (Kimata and Hase, 1989 We previously obtained a cDNA for Fd I from a cDNA library of maize
leaves (Hase et al., 1991a Plant Materials
Purification of Fd Isoproteins from Maize Leaves About 250 g of leaf tissue was homogenized with a Waring blender in 1 L of an ice-cold extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 0.5 mM EDTA, 0.5% [v/v] 2-mercaptoethanol, and 1 mM PMSF) containing 10% (w/v) Polyclar AT. The homogenate was filtered through two layers of Miracloth (Calbiochem). The leaf debris were ground further in a mortar with a pestle in a small volume of extraction buffer containing quartz sand. The combined filtrate was centrifuged at 10,000g for 10 min at 4°C. The supernatant was fractionated by the addition of ammonium sulfate to 70% saturation, and the resulting precipitated material was removed by centrifugation at 12,000g for 10 min. The supernatant containing Fd isoproteins was passed through a small DE-52 column (Whatman), and absorbed proteins were eluted with 50 mM Tris-HCl, pH 7.5, and 700 mM NaCl. Fd isoproteins were isolated by successive chromatography on a Sephadex G-75 column (Pharmacia), a DE-52 column, and a Phenyl-Superose column (Pharmacia) as described previously (Hase et al., 1991aScreening of a cDNA Library, Subcloning, and Sequencing A cDNA library, constructed in pUEX1 vector (Amersham) with poly(A+) RNA prepared from maize seedlings (Sakakibara et al., 1991 UTR of pFD1 to
distinguish clones for Fd I from clones for other Fd isoproteins. The
probes were labeled by random priming (Feinberg and Vogelstein, 1984 -32P]dCTP. The probed
filters were washed under low-stringency conditions in 2× SSC (300 mM NaCl and 30 mM sodium
citrate, pH 7.0) and 0.1% (w/v) SDS at 42°C
for the first screening and under high-stringency conditions in 0.1×
SSC (15 mM NaCl and 1.5 mM sodium citrate, pH
7.0) and 0.1% (w/v) SDS at 50°C for the second screening. The filters were then subjected to autoradiography.
Extraction of RNA and Blot Analysis Total RNAs from whole leaves, MC protoplasts, and BSC strands were prepared as described previously (Sakakibara et al., 1995 -32P]dCTP. Hybridization and washing
of the filters were performed as described previously (Hase et al.,
1991a
Reduction and Carboxymethylation of Fd I and Fd II and Analysis of
Proteolytic Fragments by Capillary LC/ESI-MS
Construction of Expression Plasmids of Fd I and Fd II and Site-Directed Mutagenesis The pTrc99A expression vector (Pharmacia) was digested with PstI and HindIII, end-filled with Klenow fragment, and self-ligated to delete the PstI site in the polylinker region. The resulting vector, pTrc99A-1, was used for the construction of the expression plasmids for Fd I and Fd II. A pair of primers, ATTACCATGGCCACCTACAACGTGAAGCTGA and ATTATGCATGCTTACATGAACAGTGCT, was used to amplify a DNA fragment containing the mature region of pFD1. The PCR fragment was digested with SphI, end-filled with Klenow fragment, digested with NcoI, and inserted into the NcoI/SmaI site of pTrc99A-1 to construct the Fd I expression plasmid pTMmFD1. A unique PstI site was present at the same position of pFD1 and pFD2, and the amino acid sequences of Fd I and Fd II were identical in the region from the N terminus to the residue corresponding to the PstI site. Thus, a DNA fragment from the PstI site to an NheI site in the 3 UTR of pFD2 was replaced with
the PstI/XbaI fragment of pTMmFD1 to obtain the
Fd II expression plasmid pTMmFD2. We also altered the codon usage of
amino acids near the translation start site of pTMmFD1 and pTMmFD2 to
obtain higher expression efficiency.
Expression and Purification of Recombinant Fd Isoproteins Escherichia coli JM105 cells were transformed with the expression plasmids for Fd I or Fd II. The transformants were grown overnight at 37°C in Luria-Bertani medium containing 50 µg/mL ampicillin. The seed cultures were inoculated into 8 L of the same medium at 1% volume. The cells were grown at 37°C with vigorous aeration for 2 h. Then, isopropyl- -D( )-thiogalactopyranoside was added to a
final concentration of 0.5 mM. After further
cultivation for 8 to 12 h, the cells were collected by
centrifugation at 5,000g for 10 min and stored at
30°C. The frozen cells were suspended in 50 mM Tris-HCl, pH 7.5, containing 25% (w/v) Suc,
0.5% (v/v) 2-mercaptoethanol, and 0.5 mM PMSF
and treated with lysozyme at a concentration of 0.5 mg/mL on ice for
about 10 min. The cell suspension was diluted 2-fold with 50 mM Tris-HCl, pH 7.5, 60 mM
NaCl, and 3 mM EDTA, and then 30°C acetone
was added at a final concentration of 40% (v/v). The resulting
homogenate was centrifuged at 10,000g for 10 min. The
supernatant was passed through a DEAE-cellulose column, and the
absorbed Fd proteins were eluted with 50 mM
Tris-HCl, pH 7.5, 700 mM NaCl. Further purification of Fd isoproteins was carried out as described above.
Measurement of Oxidation-Reduction Potentials of Fds Oxidation-reduction potentials of Fd I and Fd II were measured by cyclic voltammetry using an In2O3 electrode modified with poly-L-Lys as described previously (Taniguchi et al., 1997Assay for Electron-Transfer Activity Electron-transfer activity of Fd was assayed by measuring the rate of Cyt c reduction, as described previously (Hase et al., 1991b
Cloning and Characterization of cDNAs for Fd Isoproteins in Maize Leaves Fd I and Fd II have the same N-terminal sequences up to residue 19 (Hase et al., 1991a UTR fragment of pFD1
as the probes. Twenty positive clones were obtained from 5 × 104 colonies by hybridization with the
full-length cDNA. Six of these clones, which did not hybridize with the
3 UTR fragment, were selected as candidates for clones encoding Fd II.
The 5 and 3 terminal sequences of the six clones were determined.
Four encoded the same Fd polypeptide, whose C-terminal Leu residue
agreed with that of Fd II. In the remaining two clones, one was the
same clone as pFD5 previously reported (Hase et al., 1991a
MS Analysis of Fd I and Fd II The assignment of pFD1 and pFD2 as the genes for Fd I and Fd II, respectively, was made based only on the terminal sequences of the two Fds. To obtain further structural information about Fd I and Fd II, we carried out MS. Fd I and Fd II purified from maize leaves (Fig. 2A) were reduced and carboxymethylated. They were then digested with lysylendopeptidase and subjected to capillary LC/ESI-MS. The digests of both Fds were separated into three major peaks (Fig. 2B) and their Mrs were measured. Lysylendopeptidase cleaves the polypeptide bond at the C-terminal side of Lys. Thus, the determined Mrs of each of the three peptides derived from Fd I and Fd II could be equated to those of the segments of the deduced amino acid sequences of pFD1 and pFD2, as shown in Table I. We concluded that pFD1 and pFD2 encoded Fd I and Fd II, respectively.
Cell-Specific Expression of Fd I and Fd II in Maize Leaves To investigate the expression of Fd I and Fd II genes in MC and BSC in leaves, total RNAs were isolated from whole leaves, MC, and BSC. RNA-blot analysis was performed using the restriction fragments at the 3 UTR of pFD1 and pFD2 as gene-specific probes (Fig. 1A). cDNAs for
PEPC and the Rubisco small subunit were used as the marker probes for
MC and BSC, respectively. As shown in Figure
3, the transcripts of the two Fd genes
accumulated differently in the two types of photosynthetic cells. The
probes for pFD1 and pFD2 hybridized almost exclusively with the RNA
from MC and BSC, respectively.
Expression of Fd I and Fd II cDNAs in E. coli We first developed a large-scale expression system for the Fds in E. coli (Fig. 4). The mature region of pFD1 was amplified by PCR using a pair of primers with concomitant creation of the initiation Met codon at the N terminus. This fragment was inserted under the control of the trc promoter of pTrc99A-1 to yield pTMmFD1. Next, the third nucleotides (mostly C or G) within the first 11 codons were substituted synonymously with A or T to give pTMmFD1-1. These changes in codon usage might reduce the secondary structure within the mRNA around the translation start site, thereby increasing translation efficiency in E. coli (De Boer and Hui, 1990
Electron-Transfer Ability of Fd I and Fd II Fd I and Fd II were purified from the recombinant E. coli as functional molecules with a [2Fe-2S] cluster. The recombinant Fds were indistinguishable from the authentic Fds in maize leaves in terms of their absorption spectra and mobilities on nondenaturing PAGE (data not shown). Redox potentials of Fd I and Fd II were determined to be 423 and 406 mV, respectively, by cyclic
voltammetry. These values were within the range of those reported for
various photosynthetic Fds from plants and algae (Cammack et al.,
1977
We have isolated and characterized two maize Fd cDNAs,
pFD1 and pFD2, the transcripts of which specifically accumulated in MC
and BSC, respectively. From the analysis of the purified Fds by MS, we
concluded that pFD1 and pFD2 encoded the precursors of Fd I and Fd II,
respectively. Previous analysis with nondenaturing PAGE indicated that
Fd I was distributed in the chloroplasts of both MC and BSC, whereas Fd
II was localized only in the chloroplasts of BSC (Kimata and Hase,
1989
2 Present address: Department of Biochemistry and Molecular Biology, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo, 113-8602 Japan. * Corresponding author; e-mail a-yoko{at}protein.osaka-u.ac.jp; fax 81-6-879-8613. Received August 27, 1998;
accepted November 2, 1998.
Abbreviations: BSC, bundle-sheath cell(s). ESI, electrospray ionization. FNR, Fd-NADP+ oxidoreductase. LC, liquid chromatography. MC, mesophyll cell(s). PEPC, PEP carboxylase. UTR, untranslated region.
We thank Professor Isao Taniguchi (Department of Applied Chemistry and Biochemistry, Faculty of Engineering, Kumamoto University, Japan) for measuring the redox potentials of Fds. The accession number for the nucleotide sequence data reported in this paper is AB016810.
Arnon DI (1989) The discovery of ferredoxin: the photosynthetic path. Trends Biochem Sci 13: 30-33
Asada K,
Herber U,
Schreiber U
(1993)
Electron flow to the intersystem chain from stromal components and cyclic electron flow in maize chloroplasts, as detected in intact leaves by monitoring redox change of P700 and chlorophyll fluorescence.
Plant Cell Physiol
34:
39-50
Ausbel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1991) Mutagenesis by the polymerase chain reaction. In Current Protocols in Molecular Biology. John Wiley & Sons, New York, pp 1-9 Cammack R, Rao KK, Bargeron CP, Hutson KG, Andrew PW, Rogers LJ (1977) Midpoint redox potentials of plant and algal ferredoxins. Biochem J 168: 205-209 [ISI][Medline]
Crestfield AM,
Moore S,
Stein WH
(1963)
The preparation and enzymatic hydrolysis of reduced and S-carboxymethylated proteins.
J Biol Chem
238:
622-627
De Boer HA, Hui AS (1990) Sequences within ribosome binding site affecting messenger RNA translatability and method to direct ribosomes to single messenger RNA species. Methods Enzymol 185: 103-114 [Medline] De Pascalis AR, Jelkesarov I, Ackermann F, Koppenol WH, Hirasawa M, Knaff DB, Bosshard HR (1993) Binding of ferredoxin to ferredoxin:NADP; oxidoreductase. The role of carboxyl group, electrostatic surface potential, and molecular dipole moment. Protein Sci 2: 1126-1135 [Abstract] Doulis AG, Debian N, Kingston-Smith AH, Foyer CH (1997) Differential localization of antioxidants in maize leaves. Plant Physiol 114: 1031-1037 [Abstract] Edwards G, Walker D (1983) C3, C4: Mechanisms, and Cellular and Environmental Regulation, of Photosynthesis. Blackwell Scientific Publishers, Oxford, UK Feinberg AP, Vogelstein B (1984) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 139: 266-267
Hase T,
Kimata Y,
Yonekura K,
Matsumura T,
Sakakibara H
(1991a)
Molecular cloning and differential expression of the maize ferredoxin gene family.
Plant Physiol
96:
77-83
Hase T,
Mizutani S,
Mukohata Y
(1991b)
Expression of maize ferredoxin cDNA in Escherichia coli.
Plant Physiol
97:
1395-1401
Hatch MD (1987) C4 photosynthesis: a unique blend of modified biochemistry, anatomy and ultrastructure. Biochim Biophys Acta 895: 81-106
Hatch MD
(1992)
C4 photosynthesis: an unlikely process full of surprises.
Plant Cell Physiol
33:
333-342
Izui K,
Ishijima S,
Yamaguchi Y,
Murata T,
Shigesada K,
Sugiyama T,
Katsuki H
(1986)
Cloning and sequence analysis of cDNA encoding active phosphoenolpyruvate carboxylase of the C4-pathway from maize.
Nucleic Acids Res
14:
1615-1628
Kimata Y,
Hase T
(1989)
Localization of ferredoxin isoproteins in mesophyll and bundle sheath cells in maize leaf.
Plant Physiol
89:
1193-1197
Knaff DB (1996) Ferredoxin and ferredoxin-dependent enzymes. In DR Ort, CF Yocum, eds, Oxygenic Photosynthesis: The Light Reactions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 333-361 Matsubara H, Saeki K (1992) Structural and functional diversity of ferredoxins and related proteins. Adv Inorg Chem 38: 223-280 Matsumura T, Sakakibara H, Nakano R, Kimata Y, Sugiyama T, Hase T (1997) A nitrate-inducible ferredoxin in maize roots. Genomic organization and differential expression of two nonphotosynthetic ferredoxin isoproteins. Plant Physiol 114: 653-660 [Abstract]
Matsuoka M,
Kano-Murakami Y,
Tanaka Y,
Ozeki Y,
Yamamoto Y
(1987)
Nucleotide sequence of cDNA encoding the small subunit of ribulose-1,5-bisphosphate carboxylase from maize.
J Biochem
102:
673-676
Miyake C,
Schreiber U,
Asada K
(1995)
Ferredoxin-dependent and antimycin A-sensitive reduction of cytochrome b-559 by far red light in maize thylakoids; participation of a menadiol-reducible cytochrome b-559 in cyclic electron flow.
Plant Cell Physiol
36:
743-748
Moore RC,
Black CC
(1979)
Nitrogen assimilation pathways in leaf mesophyll and bundle sheath cells of C4 photosynthesis plants formulated from comparative studies with Digitaria sanguinalis (L.) Scoop.
Plant Physiol
64:
309-313
Sakakibara H,
Fujii K,
Sugiyama T
(1995)
Isolation and characterization of a cDNA that encodes maize glutamate dehydrogenase.
Plant Cell Physiol
36:
789-797
Sakakibara H,
Kawabata S,
Hase T,
Sugiyama T
(1992)
Differential effects of nitrate and light on the expression of glutamine synthetases and ferredoxin-dependent glutamate synthase in maize.
Plant Cell Physiol
33:
1193-1198
Sakakibara H,
Shimizu H,
Hase T,
Yamazaki Y,
Takao T,
Shimonishi Y,
Sugiyama T
(1996)
Molecular identification and characterization of cytosolic isoforms of glutamine synthetase in maize roots.
J Biol Chem
271:
29561-29568
Sakakibara H,
Watanabe M,
Hase T,
Sugiyama T
(1991)
Molecular cloning and characterization of complementary DNA encoding for ferredoxin-dependent glutamate synthase in maize leaf.
J Biol Chem
266:
2028-2035
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schmutz D, Brunold C (1985) Localization of nitrite and sulfite reductase in bundle sheath and mesophyll cells of maize leaves. Physiol Plant 64: 523-528 [CrossRef] Taniguchi I, Miyahara A, Iwakiri K, Hirakawa Y, Hayashi K, Nishiyama K, Akashi T, Hase T (1997) Electrochemical study of biological functions of particular evolutionary conserved amino acid residues using mutated molecules of maize ferredoxin. Chem Lett 1977: 929-930
Copyright Clearance Center: 0032-0889/99/119//08
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
Y.-Q. Cheng, Z.-M. Liu, J. Xu, T. Zhou, M. Wang, Y.-T. Chen, H.-F. Li, and Z.-F. Fan HC-Pro protein of sugar cane mosaic virus interacts specifically with maize ferredoxin-5 in vitro and in planta J. Gen. Virol., August 1, 2008; 89(8): 2046 - 2054. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kimata-Ariga, T. Saitoh, T. Ikegami, T. Horii, and T. Hase Molecular Interaction of Ferredoxin and Ferredoxin-NADP+ Reductase from Human Malaria Parasite J. Biochem., December 1, 2007; 142(6): 715 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kimata-Ariga, G. Kurisu, M. Kusunoki, S. Aoki, D. Sato, T. Kobayashi, K. Kita, T. Horii, and T. Hase Cloning and Characterization of Ferredoxin and Ferredoxin-NADP+ Reductase from Human Malaria Parasite J. Biochem., March 1, 2007; 141(3): 421 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Saitoh, T. Ikegami, M. Nakayama, K. Teshima, H. Akutsu, and T. Hase NMR Study of the Electron Transfer Complex of Plant Ferredoxin and Sulfite Reductase: MAPPING THE INTERACTION SITES OF FERREDOXIN J. Biol. Chem., April 14, 2006; 281(15): 10482 - 10488. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Majeran, Y. Cai, Q. Sun, and K. J. van Wijk Functional Differentiation of Bundle Sheath and Mesophyll Maize Chloroplasts Determined by Comparative Proteomics PLANT CELL, November 1, 2005; 17(11): 3111 - 3140. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Okada and T. Hase Cyanobacterial Non-mevalonate Pathway: (E)-4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE SYNTHASE INTERACTS WITH FERREDOXIN IN THERMOSYNECHOCOCCUS ELONGATUS BP-1 J. Biol. Chem., May 27, 2005; 280(21): 20672 - 20679. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kurisu, D. Nishiyama, M. Kusunoki, S. Fujikawa, M. Katoh, G. T. Hanke, T. Hase, and K. Teshima A Structural Basis of Equisetum arvense Ferredoxin Isoform II Producing an Alternative Electron Transfer with Ferredoxin-NADP+ Reductase J. Biol. Chem., January 21, 2005; 280(3): 2275 - 2281. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. Hanke, Y. Kimata-Ariga, I. Taniguchi, and T. Hase A Post Genomic Characterization of Arabidopsis Ferredoxins Plant Physiology, January 1, 2004; 134(1): 255 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Holtgrefe, K. P. Bader, P. Horton, R. Scheibe, A. von Schaewen, and J. E. Backhausen Decreased Content of Leaf Ferredoxin Changes Electron Distribution and Limits Photosynthesis in Transgenic Potato Plants Plant Physiology, December 1, 2003; 133(4): 1768 - 1778. [Abstract] [Full Text] |
||||
![]() |
T. Furumoto, S. Hata, and K. Izui Isolation and Characterization of cDNAs for Differentially Accumulated Transcripts between Mesophyll Cells and Bundle Sheath Strands of Maize Leaves Plant Cell Physiol., November 1, 2000; 41(11): 1200 - 1209. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Onda, T. Matsumura, Y. Kimata-Ariga, H. Sakakibara, T. Sugiyama, and T. Hase Differential Interaction of Maize Root Ferredoxin:NADP+ Oxidoreductase with Photosynthetic and Non-Photosynthetic Ferredoxin Isoproteins Plant Physiology, July 1, 2000; 123(3): 1037 - 1046. [Abstract] [Full Text] |
||||
![]() |
K. Yonekura-Sakakibara, Y. Onda, T. Ashikari, Y. Tanaka, T. Kusumi, and T. Hase Analysis of Reductant Supply Systems for Ferredoxin-Dependent Sulfite Reductase in Photosynthetic and Nonphotosynthetic Organs of Maize Plant Physiology, March 1, 2000; 122(3): 887 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akashi, T. Matsumura, T. Ideguchi, K.-i. Iwakiri, T. Kawakatsu, I. Taniguchi, and T. Hase Comparison of the Electrostatic Binding Sites on the Surface of Ferredoxin for Two Ferredoxin-dependent Enzymes, Ferredoxin-NADP+ Reductase and Sulfite Reductase J. Biol. Chem., October 8, 1999; 274(41): 29399 - 29405. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||